genome | 17 Apr 19:09 2014

Digest for genome <at> soe.ucsc.edu - 3 updates in 3 topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Michael Moffat <moffat.michael <at> gmail.com> Apr 17 01:23PM +0100  

    Thanks for you help,
     
    I guess that the apparent link to the "Other RefSeq" track was a red
    herring. But is it possible then that these are only being called "Other
    RefSeq" because they match repeats in other species? I feel like it's worth
    an update, especially if it also affects the Other_RefSeq track.
     
    Michael
     
     
     

     

    Viviane Praz <viviane.praz <at> unil.ch> Apr 17 08:57AM +0200  

    Dear all,
     
    I've been redirected to this address about the question I asked with the
    online suggestion box. Can you please see below about the tRNA track for
    the Mouse Mm9 genome release ?
     
    Thanks a lot for your answer,
     
    Viviane Praz
     
    -------- Forwarded Message --------
    From: Ann Zweig <ann <at> soe.ucsc.edu>
    To: viviane.praz <at> unil.ch
    Subject: Re: [suggestion] GENECATS viviane.praz <at> unil.ch 2014-04-16
    16:04:36
    Date: Wed, 16 Apr 2014 16:45:50 -0700
     
    Hello Viviane,
     
    Thank you for contacting the UCSC Genome Browser. The list you have
    reached, through the on-line suggestion box, is for suggestions
    concerning new features or data sets for the Genome Browser.
     
     
    Because you have a question about data and/or use of the Browser, your
    email would be more appropriately sent to our help desk:
    genome <at> soe.ucsc.edu.
     
     
     
     
     
     
    SuggestionID:: viviane.praz <at> unil.ch 2014-04-16 16:04:36
    UserName:: Viviane Praz
    UserEmail:: viviane.praz <at> unil.ch
    Category:: Tracks
    Summary:: Mouse Mm9 tRNA track : first position of tRNA genes
    does not correspond to GtRNAdb position


    Details::
    Dear Sir/Madam,

    While using the Mm9 tRNA track on the UCSC genome browser, I
    realized that the "left" positions of the tRNA genes were
    different from the ones given in the GtRNAdb lists. All the
    genes, either plus stranded genes or minus stranded genes, have
    one more nucleotide on the "leftside" position as compared to
    GtRNAdb.
    As we need the exact positions of the tRNAs, I was wondering
    which one we should follow ?

    Thanks a lot,

    Viviane Praz

    --
    This email originated from the UCSC Genome Browser online
    suggestion form.

     

    Luvina Guruvadoo <luvina <at> soe.ucsc.edu> Apr 16 11:24AM -0700  

    Hi Rodney,
     
    Thanks for bringing this to our attention. We are looking into this bug.
    In the meantime, moving the SNP tracks above the UCSC Brain Methyl and
    UMMS Brain Hist tracks appears to be a workaround; the mouseovers will
    be correct. We apologize for the inconvenience.
     
    If you have any further questions, please reply to genome <at> soe.ucsc.edu.
    All messages sent to that address are archived on a publicly-accessible
    forum. If your question includes sensitive data, you may send it instead
    to genome-www <at> soe.ucsc.edu.
     
    - - -
    Luvina Guruvadoo
    UCSC Genome Bioinformatics Group
     
    On 4/14/2014 11:20 AM, Rodney T Perry wrote:

     

--

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 11 Apr 19:21 2014

Digest for genome <at> soe.ucsc.edu - 6 updates in 5 topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    "Namjou-Khales, Bahram" <Bahram.Namjou <at> cchmc.org> Apr 10 09:34PM  

    Dar support team: I am wondering if we can query snp (rs numbers) in new grch38 (hg38) release. It doesn't seem that the snps data has been included yet...
     
    Thanks, Bahram
     
     
    Bahram Namjou, MD
    Research Associate
    Center for Autoimmune Genomics and Etiology
    Cincinnati Children's Hospital Medical Center
    3333 Burnet Avenue Cincinnati, OH 45229-3039
    CCHMC Location S-9 098
    Office: 513-803-5076

     

    Matthew Speir <mspeir <at> soe.ucsc.edu> Apr 11 08:53AM -0700  

    Hi Bahram,
     
    Thank you for your question about SNP tracks for hg38. You are correct,
    SNP data is currently unavailable for hg38. This data will become
    available after dbSNP has released data for hg38/GRCh38, and this data
    goes through our quality assurance process. You can subscribe to our
    'genome-announce' mailing list,
    https://groups.google.com/a/soe.ucsc.edu/forum/?hl=en#!forum/genome-announce,
    to be notified when this and other major data sets become available on
    the UCSC Genome Browser. If you do not wish to subscribe to the mailing
    list, there will be a release announcement posted on the Genome
    Browser's main page at http://genome.ucsc.edu/ when this track becomes
    available.
     
    I hope this is helpful. If you have any further questions, please reply
    to genome <at> soe.ucsc.edu. All messages sent to that address are archived
    on a publicly-accessible Google Groups forum. If your question includes
    sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    Matthew Speir
    UCSC Genome Bioinformatics Group
     
     
    On 4/10/14, 2:34 PM, Namjou-Khales, Bahram wrote:

     

    Jonathan Casper <jcasper <at> soe.ucsc.edu> Apr 10 05:33PM -0700  

    Hello Emily,
     
    Thank you for using the browser and for your feature request. I have passed
    it along to our engineering team. In the meantime, you may be interested to
    know that you can right-click on items in the UCSC Genes track to directly
    request DNA. After you have highlighted an item, you can also right-click
    and select "zoom to highlighted region" to jump your browser view directly
    to your highlighted area. Clicking your browser's "back" button will return
    you to the region that you were previously looking at.
     
    I hope this is helpful. If you have any further questions, please reply to
    genome <at> soe.ucsc.edu or genome-mirror <at> soe.ucsc.edu. Questions sent to those
    addresses will be archived in publicly-accessible forums for the benefit of
    other users. If your question contains sensitive data, you may send it
    instead to genome-www <at> soe.ucsc.edu.
     
    --
    Jonathan Casper
    UCSC Genome Bioinformatics Group
     
     

     

    Matthew Speir <mspeir <at> soe.ucsc.edu> Apr 10 04:10PM -0700  

    Hi Salih,
     
    Unfortunately, we don't have an easy way for you to get only the last
    two exons from a gene. You maybe able to write a script to pull this
    information from your previous output file though.
     
    You are mostly correct about the exon numbers in the Table Browser
    output. The exon coordinates in the knownGene table are more accurately
    described as gapless blocks. Most of the time these gapless blocks
    coincide exactly with the exon boundaries. Aligning the transcripts to
    the reference genome sometimes introduces indels that create little
    breaks between these gapless blocks. This means that a single true exon
    may get broken up into separate pieces in the table - falsely inflating
    the exon count. There may be cases in your output where these exon
    numbers do not match up with the true exon number.
     
    You can get promoter regions from the Table Browser using steps nearly
    identical to those described by my colleague Steve. After you've
    followed the steps one through four he provided, you can get the
    coordinates for the upstream regions for the genes by selecting the
    'Upstream by' option, and entering the size of the regions you're
    interested in. Then click the "get BED" button.
     
    I hope this is helpful. If you have any further questions, please reply
    to genome <at> soe.ucsc.edu. All messages sent to that address are archived
    on a publicly-accessible Google Groups forum. If your question includes
    sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    Matthew Speir
    UCSC Genome Bioinformatics Group
     
     
    On 4/10/14, 4:34 AM, Tuna, Salih wrote:

     

    Graham Johnson <grahams.mailbox <at> gmail.com> Apr 10 03:07PM -0400  

    Hello,
     
    When attempting to load a custom track into my account using a bigdataurl
    window I return the following: Error TCP non-blocking connect() to
    ***.*.***.*** timed-out in select() after 10000 milliseconds - Cancelling!
    Couldn't open http://***.*.***.*** /UCSC/GDJ/rmdup.bw. I've hidden the IP
    address here. I am able to download this file from other computers using
    http://***.*.***.*** /UCSC/GDJ/rmdup.bw. So I think our connection is fine.
     
    Can you suggest anything we might try? Thank you for your time and
    assistance.
    Graham
     
    --
    Graham D Johnson
    Graduate Research Assistant
    Center for Molecular Medicine and Genetics
    Wayne State University School of Medicine
    Detroit MI 48201
    USA
     
    Phone: 313-577-0765
    FAX: 313-577-8554

     

    Pankaj Agarwal <p.agarwal <at> duke.edu> Apr 10 06:06PM  

    Hi,
     
    I am looking to download the UCSC version of the human reference annotation file (which I believe is in GTF format) from the UCSC Genome Browser website but cannot readily find the file. The closest that I saw was linked from
     
    http://hgdownload.cse.ucsc.edu/downloads.html#human
     
    to
     
    http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/
     
    But there are many files in the link above, and I am not sure which file represents the complete set of annotations.
     
    Just as a reference, the ENSEMBL provides their version of the annotation file at the following location
     
    http://www.ensembl.org/info/data/ftp/index.html
    ftp://ftp.ensembl.org/pub/release-75/gtf/homo_sapiens
     
    I am doing rna-seq data analysis for which I need the annotation file.
     
    I would appreciate your help for locating the annotation file.
     
    Sincerely,
     
    - Pankaj
     
    --------------------------------------
    Pankaj Agarwal, M.S
    Bioinformatician
    Bioinformatics Shared Resource
    Duke Cancer Institute
    Duke University
    919-681-6573
    p.agarwal <at> duke.edu<mailto:p.agarwal <at> duke.edu>

     

--

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 7 Apr 19:25 2014

Digest for genome <at> soe.ucsc.edu - 1 update in 1 topic

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

--

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 3 Apr 19:15 2014

Digest for genome <at> soe.ucsc.edu - 6 updates in 2 topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    "Rosenfeld, Jeffrey" <rosenfj1 <at> njms.rutgers.edu> Apr 03 12:08PM -0400  

    Hi,
     
    I am trying to extract 1000 Genomes allele frequencies for the MXL
    population. I see from this page:
    http://genome.ucsc.edu/goldenPath/help/haplotypes.html that it is
    possible for individual genes, but I would like to get them for the
    whole human genome as a file. Is this possible?
     
    Thanks,
     
    Jeff
     
    --
    Jeffrey Rosenfeld, Ph. D
    Assistant Professor of Medicine - Rutgers New Jersey Medical School
    OIT - High Performance and Research Computing
    973-972-1004 (voice)
    973-972-7412 (fax)
    MSB-C630
    185 South Orange Avenue
    Newark, NJ 07101
     
    Research Associate
    Sackler Institute for Comparative Genomics
    American Museum of Natural History

     

    Daofeng Li <lidaof <at> gmail.com> Apr 02 03:17PM -0500  

    Hi Jonathan,
     
    Thank you very much for your reply.
    One more question, so also for broadPeak and gappedPeak, also use bigBed
    format, but use a different .as file?
    Correct?
     
    Thank you again.
     
    Daofeng
     
     

     

    "Steve Heitner" <steve <at> soe.ucsc.edu> Apr 02 01:51PM -0700  

    Hello, Daofeng.
     
    Yes, this is correct. You can find the broadPeak and gappedPeak
    descriptions just beneath the narrowPeak description
    (http://genome.ucsc.edu/FAQ/FAQformat.html#format13 and
    http://genome.ucsc.edu/FAQ/FAQformat.html#format14) and the .as files for
    broadPeak and gappedPeak are also in the same location as the narrowPeak.as
    file
    (http://genome-source.cse.ucsc.edu/gitweb/?p=kent.git;a=tree;f=src/hg/lib/en
    code).
     
    Please contact us again at genome <at> soe.ucsc.edu if you have any further
    questions. Questions sent to that address will be archived in a
    publicly-accessible forum for the benefit of other users. If your question
    contains sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    ---
    Steve Heitner
    UCSC Genome Bioinformatics Group
     

     
    From: Daofeng Li [mailto:lidaof <at> gmail.com]
    Sent: Wednesday, April 02, 2014 1:18 PM
    To: Jonathan Casper
    Cc: genome <at> soe.ucsc.edu
    Subject: Re: [genome] big format for narrowPeak
     

     
    Hi Jonathan,
     

     
    Thank you very much for your reply.
     
    One more question, so also for broadPeak and gappedPeak, also use bigBed
    format, but use a different .as file?
     
    Correct?
     

     
    Thank you again.
     
     
     
     
    Daofeng
     

     
    On Fri, Mar 28, 2014 at 4:31 PM, Jonathan Casper <jcasper <at> soe.ucsc.edu>
    wrote:
     
    Hello Daofeng,
     
    Thank you for your question about viewing narrowPeak data in a track hub.
    narrowPeak data is stored in a BED 6+4 format
    (seehttp://genome.ucsc.edu/FAQ/FAQformat.html#format12). You can add
    narrowPeak data to a track hub by converting the narrowPeak data into a
    bigBed file, and then specifying the URL to that bigBed file in the
    bigDataUrl property.
     
    To convert a narrowPeak data file into bigBed format, use the bedToBigBed
    utility as described in Example Three on
    http://genome.ucsc.edu/goldenPath/help/bigBed.html. Example Three is
    important because it shows how to convert a file that uses additional
    non-standard BED fields. The narrowPeak format uses 4 additional
    non-standard fields. For the bedToBigBed utility to convert your data, you
    will need to provide a .as (AutoSQL) file to describe these fields. You can
    find a .as file describing the narrowPeak format in the Kent source tree, in
    the directory src/hg/lib/encode/narrowPeak.as. This file is also available
    from our online repository at
    http://genome-source.cse.ucsc.edu/gitweb/?p=kent.git;a=tree. Use this file
    as described in Example Three, and you should be able to create a bigBed
    file that contains all of your narrowPeak data.
     
    I hope this is helpful. If you have any further questions, please reply to
    genome <at> soe.ucsc.edu. Questions sent to that address will be archived in a
    publicly-accessible forum for the benefit of other users. If your question
    contains sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    --
    Jonathan Casper
    UCSC Genome Bioinformatics Group
     

     
    On Fri, Mar 28, 2014 at 8:16 AM, Daofeng Li <lidaof <at> gmail.com> wrote:
     
    Dear UCSC mailing list,
     

     
    I need add some narrowPeak tracks to our remote hub.
     
    I usually load the narrowPeak track to database when viewing it locally.
     
    For viewing narrowPeak in remote hub, which format should I use for specify
    the bigDataUrl property?
     

     
    Thanks.
     

     
    Daofeng
     
    --
     

     

     
    --

     

    Daofeng Li <lidaof <at> gmail.com> Apr 02 03:59PM -0500  

    Hi Steve,
     
    Thank you very much for reply.
    Yes, I found them and they worked perfect.
     
    While I do encounter a problem when converting gappedPeak to bigBed, I am
    not sure it's my file format problem or how could I fix this error.
     
    bedToBigBed -as=/home/dli/gappedPeak.as -type=bed12+3 y /home/dli/hg19.size
    y.bigBed
     
    pass1 - making usageList (24 chroms): 41 millis
     
    Error line 1 of y: BED blocks must span chromStart to chromEnd. BED
    chromStarts[0] = 18, must be 0 so that (chromStart + chromStarts[0]) equals
    chromStart.
     
     
    Here are some lines of my file y in gappedPeak format:
     
    chr1 723974 727047 Rank_1116 22 . 723992 727038 0
    5 584,508,241,298,352 18,1052,1743,2377,2712 2.03076 4.32095
    2.27921
     
    chr1 814267 818069 Rank_15955 8 . 816761 817048 0
    1 287 2494 2.03690 2.45937 0.85795
     
    chr1 822752 826312 Rank_11921 9 . 824956 825264 0
    1 308 2204 1.84550 2.63678 0.98213
     
    chr1 831923 834034 Rank_4006 15 . 833008 833987 0
    2 572,325 1085,1739 2.59614 3.36433 1.56091
     
    chr1 927046 928904 Rank_48625 4 . 927208 927578 0
    1 370 162 1.91915 1.88345 0.48029
     
    chr1 1033775 1036039 Rank_42052 5 . 1034184 1034424 0
    1 240 409 1.93991 1.96547 0.52877
     
     
    Thanks in advance for any response.
     
    Daofeng
     
     

     

    "Steve Heitner" <steve <at> soe.ucsc.edu> Apr 02 03:20PM -0700  

    Hello, Daofeng.
     
    The problem here is that column 12 of each line in your file should begin
    with 0, meaning that the first exon of each item in your track, whether
    coding or noncoding, should start at the very beginning of the item. If it
    does not, it will cause an error. If you treat the first 12 columns of your
    data as a BED 12 custom track and attempt to load it at
    http://genome.ucsc.edu/cgi-bin/hgCustom, you will receive the same error.
     
    Please contact us again at genome <at> soe.ucsc.edu if you have any further
    questions. Questions sent to that address will be archived in a
    publicly-accessible forum for the benefit of other users. If your question
    contains sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    ---
    Steve Heitner
    UCSC Genome Bioinformatics Group
     

     
    From: Daofeng Li [mailto:lidaof <at> gmail.com]
    Sent: Wednesday, April 02, 2014 2:00 PM
    To: steve <at> soe.ucsc.edu
    Cc: Jonathan Casper; genome <at> soe.ucsc.edu
    Subject: Re: [genome] big format for narrowPeak
     

     
    Hi Steve,
     

     
    Thank you very much for reply.
     
    Yes, I found them and they worked perfect.
     

     
    While I do encounter a problem when converting gappedPeak to bigBed, I am
    not sure it's my file format problem or how could I fix this error.
     

     
    bedToBigBed -as=/home/dli/gappedPeak.as -type=bed12+3 y /home/dli/hg19.size
    y.bigBed
     
    pass1 - making usageList (24 chroms): 41 millis
     
    Error line 1 of y: BED blocks must span chromStart to chromEnd. BED
    chromStarts[0] = 18, must be 0 so that (chromStart + chromStarts[0]) equals
    chromStart.
     

     
    Here are some lines of my file y in gappedPeak format:
     
    chr1 723974 727047 Rank_1116 22 . 723992 727038 0
    5 584,508,241,298,352 18,1052,1743,2377,2712 2.03076 4.32095
    2.27921
     
    chr1 814267 818069 Rank_15955 8 . 816761 817048 0
    1 287 2494 2.03690 2.45937 0.85795
     
    chr1 822752 826312 Rank_11921 9 . 824956 825264 0
    1 308 2204 1.84550 2.63678 0.98213
     
    chr1 831923 834034 Rank_4006 15 . 833008 833987 0
    2 572,325 1085,1739 2.59614 3.36433 1.56091
     
    chr1 927046 928904 Rank_48625 4 . 927208 927578 0
    1 370 162 1.91915 1.88345 0.48029
     
    chr1 1033775 1036039 Rank_42052 5 . 1034184 1034424 0
    1 240 409 1.93991 1.96547 0.52877
     

     
    Thanks in advance for any response.
     
     
     
     
    Daofeng
     

     
    On Wed, Apr 2, 2014 at 3:51 PM, Steve Heitner <steve <at> soe.ucsc.edu> wrote:
     
    Hello, Daofeng.
     
    Yes, this is correct. You can find the broadPeak and gappedPeak
    descriptions just beneath the narrowPeak description
    (http://genome.ucsc.edu/FAQ/FAQformat.html#format13 and
    http://genome.ucsc.edu/FAQ/FAQformat.html#format14) and the .as files for
    broadPeak and gappedPeak are also in the same location as the narrowPeak.as
    file
    (http://genome-source.cse.ucsc.edu/gitweb/?p=kent.git;a=tree;f=src/hg/lib/en
    code).
     
    Please contact us again at genome <at> soe.ucsc.edu if you have any further
    questions. Questions sent to that address will be archived in a
    publicly-accessible forum for the benefit of other users. If your question
    contains sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    ---
    Steve Heitner
    UCSC Genome Bioinformatics Group
     

     
    From: Daofeng Li [mailto:lidaof <at> gmail.com]
    Sent: Wednesday, April 02, 2014 1:18 PM
    To: Jonathan Casper
    Cc: genome <at> soe.ucsc.edu
    Subject: Re: [genome] big format for narrowPeak
     

     
    Hi Jonathan,
     

     
    Thank you very much for your reply.
     
    One more question, so also for broadPeak and gappedPeak, also use bigBed
    format, but use a different .as file?
     
    Correct?
     

     
    Thank you again.
     
     
     
     
    Daofeng
     

     
    On Fri, Mar 28, 2014 at 4:31 PM, Jonathan Casper <jcasper <at> soe.ucsc.edu>
    wrote:
     
    Hello Daofeng,
     
    Thank you for your question about viewing narrowPeak data in a track hub.
    narrowPeak data is stored in a BED 6+4 format
    (seehttp://genome.ucsc.edu/FAQ/FAQformat.html#format12). You can add
    narrowPeak data to a track hub by converting the narrowPeak data into a
    bigBed file, and then specifying the URL to that bigBed file in the
    bigDataUrl property.
     
    To convert a narrowPeak data file into bigBed format, use the bedToBigBed
    utility as described in Example Three on
    http://genome.ucsc.edu/goldenPath/help/bigBed.html. Example Three is
    important because it shows how to convert a file that uses additional
    non-standard BED fields. The narrowPeak format uses 4 additional
    non-standard fields. For the bedToBigBed utility to convert your data, you
    will need to provide a .as (AutoSQL) file to describe these fields. You can
    find a .as file describing the narrowPeak format in the Kent source tree, in
    the directory src/hg/lib/encode/narrowPeak.as. This file is also available
    from our online repository at
    http://genome-source.cse.ucsc.edu/gitweb/?p=kent.git;a=tree. Use this file
    as described in Example Three, and you should be able to create a bigBed
    file that contains all of your narrowPeak data.
     
    I hope this is helpful. If you have any further questions, please reply to
    genome <at> soe.ucsc.edu. Questions sent to that address will be archived in a
    publicly-accessible forum for the benefit of other users. If your question
    contains sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    --
    Jonathan Casper
    UCSC Genome Bioinformatics Group
     

     
    On Fri, Mar 28, 2014 at 8:16 AM, Daofeng Li <lidaof <at> gmail.com> wrote:
     
    Dear UCSC mailing list,
     

     
    I need add some narrowPeak tracks to our remote hub.
     
    I usually load the narrowPeak track to database when viewing it locally.
     
    For viewing narrowPeak in remote hub, which format should I use for specify
    the bigDataUrl property?
     

     
    Thanks.
     

     
    Daofeng
     
    --
     

     

     
    --

     

    Daofeng Li <lidaof <at> gmail.com> Apr 02 07:05PM -0500  

    Thank you Steve.
     
    Actually I tried to replace the first number in column 12 with 0 and tried
    to convert to bigBed.
    Another error happens:
     
    pass1 - making usageList (24 chroms): 34 millis
    Error line 1 of y: BED blocks must span chromStart to chromEnd.
    (chromStart + chromStarts[last] + blockSizes[last]) must equal chromEnd.
     
    Is there a way to ignore these errors and generate the bigBed files?
     
    Thanks.
     
    Daofeng
     
     

     

--

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 24 Mar 18:24 2014

Digest for genome <at> soe.ucsc.edu - 2 updates in 2 topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Gema Sanz Santos <gema.sanz.santos <at> ki.se> Mar 23 11:16AM  

    Hello,
     
    I´m trying to upload a custom track (bigwig file) to Genome Browser but I´m unable. I have my own Filezilla server but I´m not sure how to write the ftp address (track line). I already tried track: type=bigwig bigDataUrl=ftp:// //ip address/file.bigwig but is not working.
     
    Any suggestions? Do I need to open any port for UCSC?
     
    Best
    Gema
     
     
    Gema Sanz Santos, PhD
    MTC | Karolinska Institute
    Nobelsväg 16
    171 77 Stockholm
    Room H564

     

    Nicholas Price <price4890 <at> gmail.com> Mar 23 06:53PM -0500  

    Hi,
     
    I am sorry I think I didn't make my self clear. I meant what is the "raw
    quality score" based on. Meaning the methodology
    used to measure it. Is it similar to the method behind a PHRED score?
     
    Thank you
     
    Nicholas
     
     
     

     

--

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 3 Mar 18:18 2014

Digest for genome <at> soe.ucsc.edu - 5 Messages in 5 Topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Nicholas Price <price4890 <at> gmail.com> Mar 02 04:53PM -0600  

    Hi,
     
    I downloaded some Tarsier protein coding sequences from the database Ensembl
    and I was wondering if I could get a quality score for these so I can limit
    sequencing errors.
     
    Thank you
     
    Nicholas

     

    Martin Frith <martin <at> cbrc.jp> Mar 03 05:08PM +0900  

    Hello,
     
    I'm trying to understand how your hg19 versus panTro4 pairwise alignments
    were made.
     
    Your documentation says you used the "human_chimp.v2" scoring matrix with
    O=600 and E=150. However, this file:
    http://hgdownload.soe.ucsc.edu/goldenPath/hg19/vsPanTro4/axtNet/chr1.hg19.panTro4.net.axt.gz
     
    Includes for example this alignment:
    11 chr1 30873 30895 chr15_AACZ03171938_random 4887 4909 - 1847
    tctctctctctctctctctcatt
    tctctctctctctccctctcttt
     
    The score of 1847 is correct only if you used the hoxd70 scoring matrix,
    not human_chimp.v2. But I don't know if you used hoxd70 throughout your
    alignment procedure, or only in later steps, or only to re-score the
    alignments at the very end. Please could you clarify?
     
    As a related question, in the same file I saw this:
    ##gapPenalties=axtChain O=400 E=30
    ##gapPenalties=blastz O=600 E=150
    So were different gap scores used for axtChain, and what effect do they
    have (since axtChain also has a "linearGap matrix")?
     
    Have a nice day,
    Martin Frith
    http://www.cbrc.jp/~martin/

     

    Andrei Rozanski <rozanski.andrei <at> gmail.com> Mar 03 08:29AM -0500  

    Hello,
     
    Im working on liftover implementation for a script.
    However I was not able to find documentation about how to deal with gzip
    chain files in order to get the "lifted" coordinate.
    Im aware of https://genome.ucsc.edu/goldenPath/help/chain.htmlspecifications.
    Any help are welcome
     
    Best regards
     
    --
    Andrei R
    Centro de Oncologia Molecular
    Instituto Sírio-Libanês de Ensino e Pesquisa
    Hospital Sírio-Libanês
    R: Cel. Nicolau dos Santos, 69
    São Paulo-SP. 01308-060
    Phone: +55 11 3155-3704
    Fax: +55 11 3155-4220

     

    Alexandra Vatsiou <alex.vatsiou <at> gmail.com> Mar 03 03:36PM +0100  

    Hello,
     
    I know that the chain file is sufficient to convert from one assembly to
    another the SNP coordinates.
    I have the following questions:
    1. I suppose the reference sequence is the hg18 and the query is the hg38
    in the hg19ToHg38.over.chain file. Right?
     
    2. However, I can't see how exactly I will do the conversion of SNP
    coordinates between the two assemblies. The chain file contains
    a) the size of the ungapped alignment and
    b) the difference between the end of this block and the beginning of the
    next block in the reference and the query sequence.
     
    What I have is something like the following:
    SNP chr genetic dist physical dist
    rs12565286 1 0.000881697 711153 C G
    rs11804171 1 0.0058782819 713682 A T
    rs2977670 1 0.0060252705 713754 C G
    rs2977656 1 0.018904623 719811 C T
    rs12138618 1 0.0633989027 740098 A G
     
    where the fourth column is the SNP coordinates of each SNP.
    For example according to the chain file what will be the coordinate of the
    first SNP?
     
    I will greatly appreciate if anyone knows how to deal with this.
    Look forward to your reply.
     
    Regards,
    Alexandra
     
    --
    *Alexandra Vatsiou*

     

    Carlos Infante <cinfante <at> uga.edu> Mar 03 03:29PM  

    Dear UCSC,
     
    I have the same problem with bigWigs hosted on Dropbox reported by Daofeng Li<https://groups.google.com/a/soe.ucsc.edu/forum/#!searchin/genome/dropbox/genome/jytmZmvYquU/ef-OpEtUo44J> and Elphege<https://groups.google.com/a/soe.ucsc.edu/forum/#!topic/genome/P1RtZNi5pqU> After emailing back and forth with support at Dropbox, they blame UCSC web browser since they are serving the files. See the final email from Dropbox support below. Has the approach to loading custom track changed?
     
    Thanks,
     
    Carlos
     
     
    Begin forwarded message:
     
     
    I've looked into this issue further, and it appears that the issue you're experiencing comes as a result of the 3rd party website you've been using, not with Dropbox.
     
    From what we can tell, it's the website that's not loading the Dropbox links correctly; we're serving the files to the website, but we can't control how the website handles the files after we do so.
     
    I'm sorry not to be able to assist you with this issue further, and please feel free to reach out with further questions!

     

--
 

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 24 Feb 18:15 2014

Digest for genome <at> soe.ucsc.edu - 5 Messages in 5 Topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Davide Prandi <davide.prandi <at> unitn.it> Feb 24 09:03AM +0100  

    Dear genome browser admin,
     
    I'm working with old data that works with hg16 (Human Build 34) and I
    need to covert some recent data from DGV (hg19) to hg16. Could you
    please provide the chain from hg19 to hg16 and viceversa?
     
    Best,
    Davide
     
    --
    Davide Prandi, PhD.
    Centre for Integrative Biology (CIBIO), University of Trento (IT)
    Via Sommarive, 5, building Povo2
    38123 Povo - Trento (Italy)
    tel.: +39 0461 282791
    email: davide.prandi <at> unitn.it

     

    Kai Zhang <kai <at> kzhang.org> Feb 23 06:43PM -0800  

    Hi UCSC,
     
    I would like to know how to retrieve the download link for a specific file
    name e.g. wgEn codeHaibTfbsH1hescAtf3V0416102AlnRep1.bam, through UCSC
    Public MySQL server? Because I have hundreds of file names obtained from
    querying the metaDb, and I want to get the download links of these files
    now. Thanks!
     
    Best,
     
    --
    Kai

     

    "Serrao, Erik A." <Erik_Serrao <at> DFCI.HARVARD.EDU> Feb 22 08:20PM  

    Hello,
     
    I am a postdoc at Harvard Medical School, and I would like to use BLAT to align thousands of individual human DNA sequences. Can you please suggest a method to do this as efficiently as possible? I am not very programming-literate, but I have heard that doing a local BLAT install may be a good idea. Would you be able to walk me through this or offer other useful ideas?
     
    Thanks so much,
     
    Erik
     
     
    The information in this e-mail is intended only for the person to whom it is
    addressed. If you believe this e-mail was sent to you in error and the e-mail
    contains patient information, please contact the Partners Compliance HelpLine at
    http://www.partners.org/complianceline . If the e-mail was sent to you in error
    but does not contain patient information, please contact the sender and properly
    dispose of the e-mail.

     

    "Yu, Jiamei" <JiameiYu <at> mednet.ucla.edu> Feb 22 01:10AM  

    I have genomic coordinates for Vysis LSI HER2 is: chr17:37,751,146-37,976,854, genomic coordinates for Abbott 17p is: chr17:52,271-136,647, genomic coordinates for ABsubTel17q is: chr17:80,549,525-80,969,618, how do I know the genomic coordinates for these 3 genes are GRCh37/hg19 or NCBI36/hg18?
     
    ________________________________
     
    IMPORTANT WARNING: This email (and any attachments) is only intended for the use of the person or entity to which it is addressed, and may contain information that is privileged and confidential. You, the recipient, are obligated to maintain it in a safe, secure and confidential manner. Unauthorized redisclosure or failure to maintain confidentiality may subject you to federal and state penalties. If you are not the intended recipient, please immediately notify us by return email, and delete this message from your computer.

     

--
 

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 13 Feb 18:16 2014

Digest for genome <at> soe.ucsc.edu - 4 Messages in 4 Topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Reinhard Ebner <reinhard.ebner <at> yahoo.com> Feb 12 05:16PM -0800  

    Hi,
    quick question: in the Mapping&Sequencing section, above Genes&Gene Predictions,
    FISH mapped clones are shown as either green or red blocks. - Is there any significance
    to this color assignment, i.e. a difference between red and green BAC clones?
     
    Thank you,
    R. Ebner

     

    "Henagan, Tara M" <thenagan <at> purdue.edu> Feb 13 03:06AM  

    Hi,
     
    I understand that in the custom genome browser, all data map to the positive strand and only coordinates for the positive strand are shown in the browser. Thus, any data for genes that are encoded on the negative strand, are shown on the positive, with positive coordinates (not the negative strand coordinates). However, when I download the RefSeq Genes table from the UCSC database or use the other available tools from the website to annotate my data, start and end positions for genes encoded on the negative strand are given as coordinates on the negative strand. Therefore, these coordinates do not match the coordinates when I browse for the gene in the browser.
     
    My particular gene of interest is PPARGC1a. With the mm9 genome, the browser gives a start position of chr5:51845488 and end of 51945160. The Ref Seq table gives a start (transcription start) of 51454249 and end of 51553921.
     
    How do I convert the coordinates from the RefSeq Genes table to the coordinates in the browser? In other words, what is the formula to convert coordinates from the negative to the positive strand?
     
    It seems that I should be able to do the chromosome size - negative strand start = positive strand end. However, this does not work.
     
    Also, the website says there is a convert utility that will do batch coordinate conversions and supports conversions between forward and reverse, but when I go to the website look for the tool, it appears that I can only use this utility to convert across genomes. Is there an available tool/utility to batch convert coordinates on the negative/minus strand to coordinates on the positive/plus strand?
     
    Thank you,
    Tara

     

    "Jiang, Zhijie" <ZJiang <at> med.miami.edu> Feb 13 10:31AM -0500  

    Hi,
    According to NCBI refseq, gene IRF2 locates at chr4: 184387713-184474580 (http://www.ncbi.nlm.nih.gov/gene/3660), but when I looked at this region on UCSC genome browser, this gene is not displayed. After searching I found out that the browser use a coordinate different from the NCBI's. so which one is right?
     
    I also found the similar case on other genes on chr4.
     
    Thanks,
    Zhijie

     

    #WONG WEI JIAT# <WJWONG1 <at> e.ntu.edu.sg> Feb 13 11:00AM  

    Hi UCSC,
     
     
    I've have problem displaying the snp130Seq track on my local ucsc browser.
     
     
    I downloaded it as follows:
     
    sudo rsync -avP rsync://hgdownload.cse.ucsc.edu/mysql/hg18/snp130Seq.* /var/lib/mysql/hg18/
     
     
    Is there any other steps which are needed?
     
     
    Best,
     
    Ryan

     

--
 

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 28 Jan 18:12 2014

Digest for genome <at> soe.ucsc.edu - 4 Messages in 3 Topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    #WONG WEI JIAT# <WJWONG1 <at> e.ntu.edu.sg> Jan 28 02:06PM  

    Hi UCSC Genome team,
     
    Can I know which format will you recommend for insertion of tracks with specification as stated below:
     
    I have 1000 x and y coordinates respectively and I which to plot this graph on my local ucsc browser which I installed recently.
    Would appreciate if you could help.
     
    Thanks,
    Ryan

     

    "David A. Hendrix" <dhendrix <at> csail.mit.edu> Jan 27 09:51PM -0800  

    Hi. Love the ucsc site!!! I use it all the time.
     
     
    I was trying to download zebrafish data with the table browser. At the top
    of the page was this printout:
     
    Track pubsBingBlat has group pub, which isn't in grp table
    Content-Type:text/html
     
    This seems like it was a debugging printout? I tried to download a gtf, but
    it simply print the contents to a web page, and did not create a file to
    download. I assume the two are related, but not sure. I was trying to
    download zebrafish data for danRer7.
     
    Thanks!
    David

     

    Barry Starr <bstarr <at> thetech.org> Jan 27 11:35AM -0800  

    Hello
     
    I am trying to figure out if Neandertals and/or Denisovans had Rh+ or Rh-
    blood. To do this, I need to bring up their RhD genes but am finding it
    really hard to do. Can you take me through how to do it?
     
    Thanks
     
    Barry
     
    --
    Dr. D. Barry Starr
    Director, Outreach Activities<http://genetics.stanford.edu/outreach/tech.html>
    Website: Understanding Genetics <http://www.thetech.org/genetics/>

     

--
 

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 27 Jan 18:19 2014

Digest for genome <at> soe.ucsc.edu - 4 Messages in 4 Topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Rodney T Perry <rperry <at> uab.edu> Jan 27 04:29PM  

    This is a technical or syntax question regarding gene names that I can't find an answer to and hope you can help me with it. According to the HUGO and International workshop on Human Gene Nomenclature Guidelines (Blake JA et al, 1997; Wain HM et al, 2002), gene symbols for human genes should be in all capital letters and italicized (Ex. APOE is located on chromosome 19) while human proteins are not italicized (The gene that codes for APOE is located on chromosome 19). But these articles do not suggest what to do when the gene symbol is descriptive such as, "The APOE gene is located on chromosome 19". I've always understood that in this case the word, "APOE" is used as an adjective and so should be interpreted as the gene coding for APOE (the protein), similar to the wording and meaning for the protein example I used above. Therefore, it should NOT be italicized. Can you clarify this and, if possible cite a reference for this? Thank you.
     
    R. Perry

     

    lenis vasilis <val1 <at> aber.ac.uk> Jan 27 04:20PM  

    Hello everybody,
     
    I'm trying to generates the chains & nets from an alignment file (chr1 from chicken as the target and the genome of Zebra finch as the query) and it gives me the following error:
     
    951 blocks after duplicate removal
    Loaded 72861351 bases from chrZ fa
    Loaded 195276750 bases from chr1 fa
    chainPair chrZ-chr1
    query chrZ block 73188236-73188393 exceeds sequence length 72861351
     
    Is there anyone who could help me with that?
     
    Thank you very much in advance,
    Vasilis.

     

    <mail.bioinfo <at> fr.netgrs.com> Jan 27 09:31AM  

    Hello Pauline
     
    Thanks for your reply.
     
    Best Regards - Cordialement,
    -----------------------------------------------------------------------
    Joel Masciocchi
    Bioinformatician
    Informatics Department
    Institut de Recherches SERVIER (I.d.R.S)
    125, chemin de Ronde
    78290 CROISSY-SUR-SEINE - FRANCE
     
     
     
    -----Message d'origine-----
    De : Pauline Fujita [mailto:pauline <at> soe.ucsc.edu]
    Envoyé : vendredi 24 janvier 2014 22:38
    À : <FRsr BioInfo
    Cc : UCSC Genome Browser discussion list; HAUDRY Yannick IDRS
    Objet : Re: [genome] RE: Question regarding RefSeq GTF file generated from Table Browser
     
    Hello Joel,
     
    Thank you for your interest in the Genome Browser. RefSeq genes can align multiple times to the genome. Since GTF requires unique names, the string "dup#" is added to the names that appear more than once.
     
    Hopefully that answers your question. If you have any further questions, please reply to genome <at> soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    Best regards,
     
    Pauline Fujita
    UCSC Genome Bioinformatics Group
    http://genome.ucsc.edu
     
     
     

     

    Christine Pak <ackermac <at> ohsu.edu> Jan 26 10:47PM  

    Dear UCSC Genome,
     
    I have a quick question that I cannot seem to find the answer for....
     
    Is there a way to download the genomic positions for a list of specified genes? Like a bulk download for approx 1550 of my favorite genes?
     
    Thank you for your help.
     
    Sincerely,
    Christine Ackerman

     

--
 

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.
genome | 23 Jan 18:19 2014

Digest for genome <at> soe.ucsc.edu - 2 Messages in 2 Topics

Group: http://groups.google.com/a/soe.ucsc.edu/group/genome/topics

    Jonathan Casper <jcasper <at> soe.ucsc.edu> Jan 22 02:41PM -0800  

    Hello Inbal,
     
    If you are running the hgWiggle program only on local files, you do not
    need a .hg.conf file. What you do need are a .wib file, which you already
    have, and a .wig file that describes the structure of the .wib. For your
    example phyloP44wayPlacMammal.wib file, you would need to download the
    following description file:
    http://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/phyloP44wayPlacMammal.txt.gz.
    More information about how to obtain these files and use them with hgWiggle
    is available on our wiki at
    http://genomewiki.ucsc.edu/index.php/Using_hgWiggle_without_a_database. If
    you are interested, more information about the wig/wib file format is also
    available at http://genomewiki.ucsc.edu/index.php/Wiggle.
     
    I hope this is helpful. If you have any further questions, please reply to
    genome <at> soe.ucsc.edu. Questions sent to that address will be archived in a
    publicly-accessible forum for the benefit of other users. If your question
    contains sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    --
    Jonathan Casper
    UCSC Genome Bioinformatics Group
     
     

     

    "Steve Heitner" <steve <at> soe.ucsc.edu> Jan 22 10:43AM -0800  

    Hello, Ele.
     
    I assume you are referring to the previously-answered mailing list question
    at
    https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/p-7101I71ak/G5fidhNWLl
    IJ. The GENCODE and Ensembl data sets are essentially the same and
    fortunately, mm10 does have an Ensembl Genes track. Perform the following
    steps to obtain rRNA info from the Ensembl Genes track for mm10:
     
    1. Navigate to http://genome.ucsc.edu/cgi-bin/hgTables
     
    2. Select the following options:
    Clade: Mammal
    Genome: Mouse
    Assembly: Dec. 2011 (GRCm38/mm10)
    Group: Genes and Gene Prediction Tracks
    Track: Ensembl Genes
    Table: ensGene
    Region: genome
     
    3. On the "filter" line, click the "create" button
     
    4. In the "Linked Tables" section, check the mm10.ensemblSource checkbox
     
    5. Click the "allow filtering using fields in checked tables" button
     
    6. In the "mm10.ensemblSource based filters" section, the "source" line
    should read: source does match rRNA
     
    7. Click the "submit" button
     
     
     
    8. Click the "get output" button
     
    Please contact us again at genome <at> soe.ucsc.edu if you have any further
    questions. All messages sent to that address are archived on a
    publicly-accessible Google Groups forum. If your question includes
    sensitive data, you may send it instead to genome-www <at> soe.ucsc.edu.
     
    ---
    Steve Heitner
    UCSC Genome Bioinformatics Group
     

     
    From: Eleonora Adami [mailto:peppina1 <at> hotmail.com]
    Sent: Wednesday, January 22, 2014 7:59 AM
    To: genome <at> soe.ucsc.edu
    Subject: [genome] rRNA from mm10
     

     
    Dear Bioinformatic Group,
     
    I saw in one discussion on the google group that you suggest to retrieve
    rRNA info from the wgEncodeGencodeBasicV17 table, as far as the human
    annotation goes. What is your advice if i want to extract info for mouse
    mm10?
     

     
    Best,
     
    Ele
     
    --

     

--
 

To unsubscribe from this group and stop receiving emails from it, send an email to genome+unsubscribe <at> soe.ucsc.edu.

Gmane