headers
Sean Davis | 1 Apr 2012 15:19
Picon

Re: Using the untar() with getGEOSuppFiles()

On Sat, Mar 31, 2012 at 5:58 AM, Ovokeraye Achinike-Oduaran
<ovokeraye <at> gmail.com> wrote:
> Hi all,
>
> I'm having a difficult time using the untar() after I retrieve the
> supp files using getGEOSuppFiles(). I tried it with gse15653 and
> gse12643. Both times different errors and I'm not quite sure what else
> to do. My goal is to retrieve the associated .cel files. Please help.

Thanks for the report.  This should be fixed now.  Give things a day
or so to move through the build system.

Sean

> Thanks.
>
> -Avoks
>
>> untar("GSE12643/GSE12643_RAW.tar", files = NULL, list = FALSE, exdir = ".",
> +       compressed = gzip, extras = NULL, verbose = FALSE,
> +       tar = Sys.getenv("TAR"))
> Error in rawToChar(block[seq_len(ns)]) :
>  embedded nul in string:
>
'\023Ö\030ÛT×\002 <at> Êe4-\024üWÙ&Ù?i0Ú‡"XRâæCGw÷\001\024uA<°§Êœºb•ýó•6…XR\004Q\036¤\v­4 <at> ÔYÏ=m\020B
éÙ9Ô¸ Ÿ²“áŠL €O ¹ô”Ð\0>í}]Dw¨®D\036‘'
>>
>> untar("GSE15653/GSE15653_RAW.tar", files = NULL, list = FALSE, exdir = ".",
> +       compressed = gzip, extras = NULL, verbose = FALSE,
> +       tar = Sys.getenv("TAR")
(Continue reading)

Permalink | Reply | 0 comments |
headers
Wolfgang Huber | 1 Apr 2012 23:13
Picon

DESeq countDataSets and arrayQualityMetrics (was: Re: DESeq estimateDispersion options for lower depth miRNA-seq)

Dear Praful,

DESeq >=1.9.1 in the devel branch contains a new function 
varianceStabilizingTransformation that returns the variance-stabilised 
data in an ExpressionSet, which you can then directly feed to 
arrayQualityMetrics, e.g. like this:

library("pasilla")
library("vsn")
library("arrayQualityMetrics")

data("pasillaGenes")

cdsBlind = estimateDispersions(estimateSizeFactors(pasillaGenes), 
method="blind")
pasillaVst = varianceStabilizingTransformation(cdsBlind)

meanSdPlot(pasillaVst)

arrayQualityMetrics(pasillaVst, intgroup=c("condition", "type"), force=TRUE)

Let me know if this works for you. As usual, the code will need a day or 
two to percolate from the svn archive to the website.

Kind regards
	Wolfgang

Mar/29/12 9:53 PM, Wolfgang Huber scripsit::
>
> Dear Praful
(Continue reading)

Permalink | Reply | 0 comments |
headers
Javier Pérez Florido | 2 Apr 2012 09:47
Picon

Definition of probes in lumiHumanAll annotation database

Dear list,
I've checked all the annotation elements given by lumiHumanAll.db and, 
as far as I know, none of them provides the definition of probes. If I'm 
not wrong, this definition can distinguishes isoforms and other factors.
How can I get such information from the lumiHumanAll annotation file? 
For example, gene A1CF has three different probes, corresponding each 
one to a different transcript variant, but I cannot obtain such 
information from the lumiHumanAll database.

Thanks,
Javier

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
Permalink | Reply | 4 comments |
headers
Mark Dunning | 2 Apr 2012 12:11
Picon

Re: Definition of probes in lumiHumanAll annotation database

Hi Javier,

I'm afraid I'm not clear about what you mean by probe definitions.
Rather than being Refseq-centric, the illuminaHumanv1.db,
illuminaHumanv2.db, illuminaHumanv3.db, illuminaHumanv4.db packages
provide an interface to individual probe sequences and quality
information, if this is helpful?

probes <- unlist(mget("A1CF", revmap(illuminaHumanv4SYMBOL)))

> probes
         A1CF1          A1CF2          A1CF3
"ILMN_1779670" "ILMN_1806310" "ILMN_2383229"

>  mget(probes, illuminaHumanv4PROBESEQUENCE)
$ILMN_1779670
[1] "GGCACATGCCCAGAGCCAGAAGCGAGCATGAGCACAGCAATTCCTGGCCT"

$ILMN_1806310
[1] "GAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCAC"

$ILMN_2383229
[1] "TGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAG"

>  mget(probes, illuminaHumanv4GENOMICLOCATION)
$ILMN_1779670
[1] "chr10:52610480:52610529:-"

$ILMN_1806310
[1] "chr10:52566496:52566545:-"
(Continue reading)

Permalink | Reply | 1 comment |
headers
Eric P | 1 Apr 2012 21:52
Picon

Tktable 2.9 makefile problem

Hello,

I am sorry to bother everybody but I have been trying to solve this
problem to long with no success, it is probably something really
simple but I simply cannot find the answer.

I have a question on how to get bioconductor running properly on
Ubuntu 11.10 as I have tried everything it seems like and I keep on
getting this message. But before I go farther can you please email and
say that you will help me with this because nobody seems to want to
help or know how to.

"Cannot find Tcl/Tk package "Tktable". affylmGUI cannot conitnue...."

I have installed BWidget like it tells me to.

I have tried to install Tktable 2.9 but cannot. When I try to do so I
cannot run the make file properly. Then I have ran ./configure >
output and gotten /Tktable2.9$ ./configure > output
> configure: WARNING: "Cannot find Tcl configuration definitions"

And at this point I have really no idea what to do...So please some
one help me....

Below is what happening when I try to install Tktable 2.9

I might be a bit absentminded because I am a PhD student and am quite
busy but I hope I can answer back as soon as someone gets in touch
with me.
(Continue reading)

Permalink | Reply | 2 comments |
headers
Ekta Jain | 2 Apr 2012 13:41

Re: DNAcopy for CNV in SNP Affy 6.0

Dear Vincent,
Spot on. Many Thanks. Works fine now.

Wondering if at all there is a way to create genome plots per sample (23 plots per chromosome) but showing
gains and losses per sample through all chromosomes ?

Many Thanks,
--E

From: Vincent Carey [mailto:stvjc@...]
Sent: 30 March 2012 17:56
To: Ekta Jain
Cc: bioconductor@...
Subject: Re: [BioC] DNAcopy for CNV in SNP Affy 6.0

Somewhat unlikely that you will get much help using an R 2.9.1 -- please upgrade to 2.14.1, install with
biocLite, and try again.
On Fri, Mar 30, 2012 at 8:14 AM, Ekta Jain
<Ekta_Jain@...<mailto:Ekta_Jain@...>> wrote:
Dear All,
I am trying to use the DNAcopy package to perform CBS segmentation on my copy number data. As given in the
manual, i have created my CNA.object by reading a file for chromosome, position and values for one sample.
When performing smoothed.CNA.object <- smooth.CNA(CNA.object) I get  the following error:
> smoothed.CNA.object <- smooth.CNA(CNA.Object)
Error in if (xi > max(xnbhd) + oSD) xi <- median(c(xi, xnbhd)) + sSD :
 missing value where TRUE/FALSE needed
In addition: Warning message:
In max(xnbhd) : no non-missing arguments to max; returning -Inf

I will highly appreciate if someone can tell me where could i be possibly going wrong?
(Continue reading)

Permalink | Reply | 1 comment |
headers
Javier Pérez Florido | 2 Apr 2012 13:49
Picon

Re: Definition of probes in lumiHumanAll annotation database

Thanks,
I meant information such as:
Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 
2, mRNA.
Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 
1, mRNA.
Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 
3, mRNA.

Since the gene A1CF has three different probes each one related to a 
given transcript variant. Don't know how to find the above information 
through either illuminaHumanv4.db or lumiHumanAll.db annotation packages.

Thanks,
Javier

On 02/04/2012 12:11, Mark Dunning wrote:
> Hi Javier,
>
> I'm afraid I'm not clear about what you mean by probe definitions.
> Rather than being Refseq-centric, the illuminaHumanv1.db,
> illuminaHumanv2.db, illuminaHumanv3.db, illuminaHumanv4.db packages
> provide an interface to individual probe sequences and quality
> information, if this is helpful?
>
> probes<- unlist(mget("A1CF", revmap(illuminaHumanv4SYMBOL)))
>
>> probes
>           A1CF1          A1CF2          A1CF3
> "ILMN_1779670" "ILMN_1806310" "ILMN_2383229"
(Continue reading)

Permalink | Reply | 0 comments |
headers
MLSC | 2 Apr 2012 14:30
Picon

listMart error with local biomart

Hello friends,
I was trying to set up local BioMart. BioMart web service is installed
properly. But when I connect through biomaRt using listMart(), i get
following error.

> listMarts(host="http://10.3.2.36",port=9000,
path="/home/mlsc/BioMart/release-0_8-candidate_6/")
Request to BioMart web service failed. Verify if you are still connected to
the internet.  Alternatively the BioMart web service is temporarily down.
Check http://www.biomart.org and verify if this website is available.
Error: XML content does not seem to be XML, nor to identify a file name

Can somebody suggest me, how to get out of this error?

Regards,
mlsc

	[[alternative HTML version deleted]]

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
Permalink | Reply | 2 comments |
headers
Lapointe, David | 2 Apr 2012 14:49
Favicon

Re: Tktable 2.9 makefile problem

Did you install the Tk and Tcl dev packages?

-----Original Message-----
From: bioconductor-bounces@...
[mailto:bioconductor-bounces@...] On Behalf Of Eric P
Sent: Sunday, April 01, 2012 3:52 PM
To: bioconductor@...
Subject: [BioC] Tktable 2.9 makefile problem

Hello,

I am sorry to bother everybody but I have been trying to solve this
problem to long with no success, it is probably something really
simple but I simply cannot find the answer.

I have a question on how to get bioconductor running properly on
Ubuntu 11.10 as I have tried everything it seems like and I keep on
getting this message. But before I go farther can you please email and
say that you will help me with this because nobody seems to want to
help or know how to.

"Cannot find Tcl/Tk package "Tktable". affylmGUI cannot conitnue...."

I have installed BWidget like it tells me to.

I have tried to install Tktable 2.9 but cannot. When I try to do so I
cannot run the make file properly. Then I have ran ./configure >
output and gotten /Tktable2.9$ ./configure > output
> configure: WARNING: "Cannot find Tcl configuration definitions"
(Continue reading)

Permalink | Reply | 0 comments |
headers
Syed Haider | 2 Apr 2012 14:54
Picon

Re: listMart error with local biomart

Dear MLSC,

 From the path it looks you are trying to use biomaRt to communicate to 
biomart v0.8 (release candidate 6). I believe biomaRt package does not 
support the new webservice API of biomart v0.8. It should work if your 
biomart installation was v0.7.

Best,
Syed

On 02/04/2012 13:30, MLSC wrote:
> Hello friends,
> I was trying to set up local BioMart. BioMart web service is installed
> properly. But when I connect through biomaRt using listMart(), i get
> following error.
>
>> listMarts(host="http://10.3.2.36",port=9000,
> path="/home/mlsc/BioMart/release-0_8-candidate_6/")
> Request to BioMart web service failed. Verify if you are still connected to
> the internet.  Alternatively the BioMart web service is temporarily down.
> Check http://www.biomart.org and verify if this website is available.
> Error: XML content does not seem to be XML, nor to identify a file name
>
> Can somebody suggest me, how to get out of this error?
>
> Regards,
> mlsc
>
> 	[[alternative HTML version deleted]]
>
(Continue reading)

Permalink | Reply | 1 comment |

Gmane