Heather Machado | 29 Jun 01:12 2009
Picon

SD of fitted values, lmFit (limma)

Hi all,

I am using the lmFit function in limma, and am trying to extract the
standard deviation of the fitted values.  I know that "fitted" exists to
extract the fitted values. Has anyone written script to calculate the SD of
the fitted values?

Heather Machado
Reed College

	[[alternative HTML version deleted]]

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor

Marcel Dinger | 29 Jun 03:14 2009
Picon
Picon

Re: Single channel data analysis with LIMMA

Hi Sean,

Thanks for your advice - that worked. I ended up needing to convert my 
RGList object into an MAList object anyway so that I could apply the 
avereps function (I couldn't get it to work with the RGList - it seemed 
to lose its format). Although I expect the new EList and EListRaw 
objects will soon make this "hack" redundant, for anyone interested in 
using avereps on single channel data at the moment, you simply do:

E <- new("MAList", list(targets=RG$targets, genes=RG$genes, 
source=RG$source, M=RG$Gb, A=RG$G))
E.avg <- avereps(E,ID=E$genes$ProbeName)

avereps is particularly important for doing any analysis with custom 
agilent arrays designed with Earray since it will (optionally) fill all 
remaining spots with replicates.

Since I've received a few emails after making my post on single channel 
analysis for more information, I've put my steps up on our wiki here:
http://jsm-research.imb.uq.edu.au/groupwiki/index.php?title=Single_channel_analysis_of_Agilent_microarray_data_with_Limma

Any comments for improvement are of course appreciated.

Best regards,
Marcel.

Sean Davis wrote:
>
>
> On Thu, Jun 25, 2009 at 1:56 AM, Marcel Dinger <m.dinger@... 
(Continue reading)

mauede | 29 Jun 04:26 2009
Picon

R: R: R: R: how to find the VALIDATED pair (miRNA, gene-3'UTR-sequence)

Since "mature.fa" and "maturestar.fa" contain the EXPERIMENTALLY VALIDATED miRNAs (is it TRUE ?)
,please,  assume I have read "mature.fa" into a list.
I have to retain only the  miRNAs from humans. Therefore I havel erased all the list elements whose
description does not start with "hsa". Am I mistaken ?

In our present emergency situation I have to prepare a text file containing blocks of data described in the following.
Each block contains a human VALIDATED miRNA identifier and sequence  (Example:  "hsa-miR-20a "    "UAAAGUGCUUAUAGUGCAGGUAG")
followed by the  identifier and 3'UTR sequence of ALL genes that are targeted by such a miRNA. 
Here is what my output file should look like. I have no idea what to pick as target gene identifier. But I have
to use the "hsa...." identifier for 
the human miRNAs. 

VALIDATED miRNA[1] identifer    miRNA[1] sequence       #BLOCK_1  start
target-gene[1,1]  3'UTR sequence
target-gene[1,2]  3'UTR sequence
...............................................
target-gene[1,n]  3'UTR sequence                                 #BLOCK_1  end        

VALIDATED miRNA[2] identifer    miRNA[2] sequence        #BLOCK_2  start 
target-gene[1,1]  3'UTR sequence
target-gene[1,2]  3'UTR sequence
...............................................
target-gene[1,m]  3'UTR sequence                                 #BLOCK_2  end

.....................................................................
.....................................................................

VALIDATED miRNA[k] identifer    miRNA[k] sequence        #BLOCK_k  start
target-gene[k,1]  3'UTR sequence
target-gene[k,2]  3'UTR sequence
(Continue reading)

Sean Davis | 29 Jun 04:58 2009
Picon

Re: R: R: R: R: how to find the VALIDATED pair (miRNA, gene-3'UTR-sequence)

On Sun, Jun 28, 2009 at 10:26 PM, <mauede@...> wrote:

>  Since "mature.fa" and "maturestar.fa" contain the EXPERIMENTALLY
> VALIDATED miRNAs (is it TRUE ?) ,please,  assume I have read "mature.fa"
> into a list.
> I have to retain only the  miRNAs from humans. Therefore I havel erased all
> the list elements whose description does not start with "hsa". Am I mistaken
> ?
>
That is correct, yes.

>
> In our present emergency situation I have to prepare a text file containing
> blocks of data described in the following.
> Each block contains a human VALIDATED miRNA identifier and sequence
> (Example:  "hsa-miR-20a "    "UAAAGUGCUUAUAGUGCAGGUAG")
> followed by the  identifier and 3'UTR sequence of ALL genes that are
> targeted by such a miRNA.
> Here is what my output file should look like. I have no idea what to pick
> as target gene identifier. But I have to use the "hsa...." identifier for
> the human miRNAs.
>
> VALIDATED miRNA[1] identifer    miRNA[1] sequence       #BLOCK_1  start
> target-gene[1,1]  3'UTR sequence
> target-gene[1,2]  3'UTR sequence
> ...............................................
> target-gene[1,n]  3'UTR sequence                                 #BLOCK_1
> end
>
> VALIDATED miRNA[2] identifer    miRNA[2] sequence        #BLOCK_2  start
(Continue reading)

Kasper Daniel Hansen | 29 Jun 09:16 2009
Picon

Re: Unable to install Rgraphviz

Graphvis 2.24 is a new release (very recent). I have however checked  
that on my machine (OS X Leopard), Rgraphviz and Graphviz 2.24 plays  
well together.

Please give us all of the output from the Rgraphviz installation  
attempt.

Kasper

On Jun 27, 2009, at 1:45 , anupam sinha wrote:

> Hi all,
>         I am trying to install *Rgraphviz *on an RHEL5 system. But  
> it keeps
> on giving the following error:
> *
>> source("http://bioconductor.org/biocLite.R")
>>    biocLite("Rgraphviz")*
>
>
> *make: *** [LL_funcs.o] Error 1
> ERROR: compilation failed for package ‘Rgraphviz’
> **
> *I have already installed graphviz-2.24.0*. *
>
> *> sessionInfo()
> R version 2.9.0 (2009-04-17)
> x86_64-redhat-linux-gnu
>
> locale:
(Continue reading)

mauede | 29 Jun 09:26 2009
Picon

R: R: R: R: R: how to find the VALIDATED pair (miRNA, gene-3'UTR-sequence)

Yes. I opened  and stared at file  http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl
many times. 
I thought it would be possible to extract all the fields content in there through BioMart queries. 
Basically, the match between the miRNAs from "mature.fa" and their respecive targeted genes from 
http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl
 has to be done scanning the two  files manually (basic R functions). Then some of the info extracted from 
http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl
can be used with BioMart quesries to get the 3'URT sequances.
Did I get it right ?

I infer that not all the fields in file  http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl 
can be extracted through BioMart queries (TRUE / FALSE) ?

Unluckily our group Biology professor, who could have helped with nomenclature and where to find what, is
hospitalized in critical conditions 
with a heart attack.

Thank you for your patience and understanding,
Maura

-----Messaggio originale-----
Da: Sean Davis [mailto:seandavi@...]
Inviato: lun 29/06/2009 4.58
A: mauede@...
Cc: michael watson (IAH-C); Steve Lianoglou; bioconductor List
Oggetto: Re: R: [BioC] R: R: R: how to find the VALIDATED pair (miRNA, gene-3'UTR-sequence)

On Sun, Jun 28, 2009 at 10:26 PM, <mauede@...> wrote:

>  Since "mature.fa" and "maturestar.fa" contain the EXPERIMENTALLY
(Continue reading)

michael watson (IAH-C | 29 Jun 09:47 2009
Picon
Picon

Re: R: R: R: R: how to find the VALIDATED pair (miRNA, gene-3'UTR-sequence)

Why do you need all the fields?
Don't you just need mir name (e.g. hsa-let-7d) and ensembl transcript id (e.g. ENST000000012345)?

-----Original Message-----
From: mauede@... [mailto:mauede@...]
Sent: Mon 29/06/2009 8:26 AM
To: Sean Davis
Cc: michael watson (IAH-C); Steve Lianoglou; bioconductor List
Subject: R: R: [BioC] R: R: R: how to find the VALIDATED pair (miRNA, gene-3'UTR-sequence)

Yes. I opened  and stared at file  http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl
many times. 
I thought it would be possible to extract all the fields content in there through BioMart queries. 
Basically, the match between the miRNAs from "mature.fa" and their respecive targeted genes from 
http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl
 has to be done scanning the two  files manually (basic R functions). Then some of the info extracted from 
http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl
can be used with BioMart quesries to get the 3'URT sequances.
Did I get it right ?

I infer that not all the fields in file  http://microrna.sanger.ac.uk/cgi-bin/targets/v5/download.pl 
can be extracted through BioMart queries (TRUE / FALSE) ?

Unluckily our group Biology professor, who could have helped with nomenclature and where to find what, is
hospitalized in critical conditions 
with a heart attack.

Thank you for your patience and understanding,
Maura

(Continue reading)

anupam sinha | 29 Jun 11:07 2009
Picon

Re: Unable to install Rgraphviz

Hi ,
         Attached with this mail is all of the output from my Rgraphviz
installation attempt. Thanks in advanceRegards,

Anupam Sinha
_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
Ludo Pagie | 29 Jun 11:08 2009
Picon
Picon

Re: Fisher-Yates algorithm for DNA shuffling ?

Hi Robert,

I sometimes permute the order of the motif and scan the original
DNA sequence with that (for lots of permutations of the motif). 
This may actually correspond to a permutation of the DNA
sequence at the single nucleotide level. Of course you could use
HMM approaches at higher levls for the motif as well. I'm not
sure how shuffling the motif plus scanning (multiple times)
compares computationally to permuting the DNA sequence once.

If possible you might want to consider looking at conservation
of the motif matches. Given appropriate evolutionary models for
the sequence this might represent a more solid basis for getting
to the significance of motifs.  Never did this myself though ...

Ludo

On Thu, Jun 25, 2009 at 05:14:33PM +0200, Robert Castelo wrote:
> hi Sean,
> 
> On Tue, 2009-06-23 at 19:46 -0400, Sean Davis wrote:
> > 
> > 
> > 2009/6/23 Hervé Pagès <hpages@...>
> >         Hi Robert,
> >         
> >         
> >         Robert Castelo wrote:
> >                 dear list,
> >                 
(Continue reading)

Julien Meunier | 29 Jun 12:25 2009
Picon

available gene sets for mouse 430.2


Hi,

I would like to perform a GSEA analysis with bioconductor
  (mouse 430.2 arrays). I am looking for predefined gene sets (GO term; 
pathway, TFBS, positionnal, and others) related to the mouse that are 
well defined and documented (that is, curated, up to date,
and with some information on the gene sets and their computation).

Does anyone have suggestions to help me retrieve such gene sets if they 
exist ?

Thank you,
Julien

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor


Gmane