Re: Problem using wiggle2gff3.pl

Have you tried uploading the wig file directly through GBrowse? It should automatically generate the .wib
files and conf in the userdata directory under GBrowse's temp directory. This isn't a permanent
solution, but it might confirm whether there is something you're missing, or some more general problem.

OK, then, let's assume the .wib and gff3 files are correct. I'm wondering about the data now. Is the wig file a
fixedStep or variableStep? I find that a 1 bp step, 1 bp span, fixedStep file works the best (yes, I know,
it's big), but other types work too but sometimes drops datapoints at certain views.

Another is the min-max score values. Try setting those explicitly in the conf stanza (e.g. min_score = 0,
max_score = 10). If they're not set, then graphics adaptor tries to calculate these values (I can't
remember if this defaults to local or chromosome-wide), and I'm wondering if it is choking on this step
(maybe you've got a really hot region somewhere on the chromosome?).

Finally, if you have really dense data on large chromosomes, then you may be better served by switching to
the BigWig adaptor (http://search.cpan.org/~lds/Bio-BigFile-1.04/). This adaptor is MUCH more
robust than Bio::Graphics::Wiggle and can handle dense data with ease. It's faster, doesn't lose data
precision, and doesn't drop datapoints. But it's harder to install – but well worth the effort in my
opinion. You may want to look into that if keep having problems.

From: Bremen Braun <bremen.braun@...<mailto:bremen.braun@...>>
Date: Mon, 28 Feb 2011 14:44:40 -0700
To: Timothy Parnell <timothy.parnell@...<mailto:timothy.parnell <at> hci.utah.edu>>
Cc:
"gmod-gbrowse@...<mailto:gmod-gbrowse@...ge.net>" <Gmod-gbrowse@...<mailto:Gmod-gbrowse@...ceforge.net>>
Subject: Re: [Gmod-gbrowse] Problem using wiggle2gff3.pl

All your assumptions are correct. I am getting a readable, non-zero byte .wib file, a correctly defined
GFF3 file (I had also tried just changing the feature in this file with no luck), and my stanza does have the
same feature as given in the GFF3 file. I am also using
bp_seqfeature_load.pl<http://bp_seqfeature_load.pl> to load in the GFF3 file on the server.

part_labels

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: Install gbrowse2.26 and Bio::graphics2.14

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: Bio::DB::Sam - Bio::DB::Bam::AlignmentWrapper->padded_alignment

Hi all,

Some subsequent thinking on this has lead to a modification to the  
patch.  This should be significantly more efficient.

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 7703
kr2@...

On 28 Feb 2011, at 21:50, Keiran Raine wrote:

> Hi all,
>
> (some sections of this email have been monospaced, hopefully  
> formatting will be retained)
>
> I'm encountering unexpected results from Bio::DB::Sam when  
> requesting the 'matches' component of the padded_alignment:
>
> TAAACTATAAATAGCTCCTTTCACCTTTAGTCAAAGGAAATATCAAGAAGGCCTGTAGGGTAGCTCCCTATGGCTGTTTAAAAAGTGTTTGATTTTTATG
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> | 
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> TAAACTATAAATAGCTCCTTCCACCTTTAGTCAAAGGAAATATCAAGAAGGCCTGTAGGGTAGCTCCCTATGGCTGTTTAAAAAGTGATTGGTTTTTTTT
>                      
> *                                                                   
> *   *     * *
>
> I've indicated with '*' where I would not expect to see the '|'  
> symbol in the match string.
>
> I've written a patch that resolves this (attached), it may not be  
> the most efficient way to do it but it gives the correct result:
>
> TAAACTATAAATAGCTCCTTTCACCTTTAGTCAAAGGAAATATCAAGAAGGCCTGTAGGGTAGCTCCCTATGGCTGTTTAAAAAGTGTTTGATTTTTATG
> ||||||||||||||||||||  
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  
> ||| ||||| |
> TAAACTATAAATAGCTCCTTCCACCTTTAGTCAAAGGAAATATCAAGAAGGCCTGTAGGGTAGCTCCCTATGGCTGTTTAAAAAGTGATTGGTTTTTTTT
>
> Kind regards,
>
> Keiran Raine
> Senior Computer Biologist
> The Cancer Genome Project
> Ext: 7703
> kr2@...
>
> <AlignWrapper.pm.patch>

--

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: Bio::DB::Sam - Bio::DB::Bam::AlignmentWrapper->padded_alignment

Hi,

Maybe it is counterintuitive but the pipe symbol indicates that there
is an "M" in the CIGAR string there, not that the bases are equal.
Your patch makes sense, but before I commit it could I confirm that
nobody is depending on the current behavior?

Lincoln

On Tuesday, March 1, 2011, Keiran Raine <kr2@...> wrote:
> Hi all,
> Some subsequent thinking on this has lead to a modification to the patch.  This should be significantly
more efficient.
>
>
> --
>  The Wellcome Trust Sanger Institute is operated by Genome Research
>  Limited, a charity registered in England with number 1021457 and a
>  company registered in England with number 2742969, whose registered
>  office is 215 Euston Road, London, NW1 2BE.
>
>

--

-- 
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa@...>

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

Re: Bio::DB::Sam - Bio::DB::Bam::AlignmentWrapper->padded_alignment

Hi Lincoln,

Just to confirm, I don't mind which character denotes the mis-match (I  
understand it may want to be '-' to indicate it was not a ins/del  
region).

Thanks,

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 7703
kr2@...

On 1 Mar 2011, at 10:17, Lincoln Stein wrote:

> Hi,
>
> Maybe it is counterintuitive but the pipe symbol indicates that there
> is an "M" in the CIGAR string there, not that the bases are equal.
> Your patch makes sense, but before I commit it could I confirm that
> nobody is depending on the current behavior?
>
> Lincoln
>
> On Tuesday, March 1, 2011, Keiran Raine <kr2@...> wrote:
>> Hi all,
>> Some subsequent thinking on this has lead to a modification to the  
>> patch.  This should be significantly more efficient.
>>
>>
>> --
>> The Wellcome Trust Sanger Institute is operated by Genome Research
>> Limited, a charity registered in England with number 1021457 and a
>> company registered in England with number 2742969, whose registered
>> office is 215 Euston Road, London, NW1 2BE.
>>
>>
>
> -- 
> Lincoln D. Stein
> Director, Informatics and Biocomputing Platform
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Renata Musa <Renata.Musa@...>

--

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

problem in running gbrowse 2.23 Examples.

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: problem in running gbrowse 2.23 Examples.

Hi Unam,

Did you specifically configure GBrowse to use NSF locks for sessions?
That is what the first error message is referring to.  Are you sure
you installed the required prerequisites correctly, specifically
CGI::Session?  If so, perhaps you could send us the contents of
GBrowse.conf so we can look for strange entries.

Scott

On Tue, Mar 1, 2011 at 12:30 AM, Unam Unar <unamunar@...> wrote:
> Dear sir
>
> I have install gbrowse 2.23 successfully, means no error message found and
> it showing its
> welcome page successfully, But not going further with any link like example
> database yeast.
> It shows a 500 internal server error (The server encountered an internal
> error or misconfiguration
>  and was unable to complete your request.).
>
> in the error log their is a few error messages
>
> [Tue Mar 01 10:55:59 2011] [error] [client ::1] [32181] ...timeout waiting
> for lock after 10.000s at
> /usr/local/lib64/perl5/Bio/Graphics/Browser2/Session.pm line 185., referer:
> http://localhost/GBrowse2/
> [Tue Mar 01 10:55:59 2011] [error] [client ::1] Can't call method "param" on
> an undefined value at
> /usr/local/lib64/perl5/Bio/Graphics/Browser2/Session.pm line 314., referer:
> http://localhost/GBrowse2/
> [Tue Mar 01 10:55:59 2011] [error] [client ::1] Premature end of script
> headers: gbrowse, referer: http://localhost/GBrowse2/
>
> What i can do now, after that i will get success to run it properly.
>
> Regards
> Unam
>
>
> ------------------------------------------------------------------------------
> Free Software Download: Index, Search & Analyze Logs and other IT data in
> Real-Time with Splunk. Collect, index and harness all the fast moving IT
> data
> generated by your applications, servers and devices whether physical,
> virtual
> or in the cloud. Deliver compliance at lower cost and gain new business
> insights. http://p.sf.net/sfu/splunk-dev2dev
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

--

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

Bug in Bio::DB::Sam::SamToGBrowse->wiggle_one_bam()

Hi,

There appears to be a bug when running the above module when running  
the bw generation script in the form:

bin/bamToGBrowse.pl /path_to_bams/ /path_to_ref/fasta.fa

The module is attempting to check for the $chrom_sizes file before  
evaluating if the path should be generated from the $self->fasta  
variable.

The attached patch will resolve this problem.

Kind regards,

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 7703
kr2@...

--

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev 

_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Gbrowse2.26: cgi->redirect

Hi,

I want to insert $cgi->redirect command(for user authentication) in gbrowse code, but it always hangs on
it. How I can make it work?

Thanks,
Mustafa. 

------------------------------------------------------------------------------
Free Software Download: Index, Search & Analyze Logs and other IT data in 
Real-Time with Splunk. Collect, index and harness all the fast moving IT data 
generated by your applications, servers and devices whether physical, virtual
or in the cloud. Deliver compliance at lower cost and gain new business 
insights. http://p.sf.net/sfu/splunk-dev2dev