Dave Clements | 1 Feb 2011 06:50
Favicon
Gravatar

March 2011 GMOD Meeting Registration is now open

Hello all,

Registration is now open for the March 2011 GMOD Meeting (http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting). This meeting will be held March 5-6, as part of GMOD Americas 2011, which also includes a day of Satellite Meetings, a GMOD Course (already full), and for the first time, an "Introduction to GMOD" session the night before the meeting for GMOD newcomers. GMOD Americas 2011 events are being held at the US National Evolutionary Synthesis Center (NESCent) in Durham, North Carolina, United States.

As with previous GMOD meetings, this meeting will have a mixture of project talks, component talks, and user talks. Our guest speaker is Dr. Eric Stone of North Carolina State University.  Dr. Stone will talk about his experience on the "Drosophila Genome Reference Panel," a project that is sequencing 192 lines.  See http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda for more.

The agenda is driven by attendee suggestions, and you are encouraged to add your suggestions now (http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda_Proposals). For examples of what happens at a GMOD meeting, see the writeup of the September 2010 GMOD Meeting (http://gmod.oicr.on.ca/wiki/September_2010_GMOD_Meeting), or any previous meeting. GMOD meetings are an excellent way to meet GMOD developers and users and to learn (and affect) what's coming in the project.

Registration for the March 2011 GMOD Meeting is
  $80 on or before February 18 <<<<=======
  $95 after February 18

Please register early, both to save money, and ensure a spot. You are also strongly encouraged to sign up for (or propose) a Satellite Meeting (more details to come). Details on transportation, suggested lodging, and other logistics are on the GMOD Americas 2011 page.

This meeting, and all GMOD Americas 2011 events, are jointly sponsored by NESCent and the Galaxy Project.
------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Vittorio Zamboni | 1 Feb 2011 08:15
Picon

Re: DNA features not loading

Hello,

I figure out what I am missing in the configuration: the "global feature = 1". 
I thought it was not binding. 
Thank you for your help,

Vittorio

Il giorno 22/nov/2010, alle ore 23.01, Lincoln Stein ha scritto:

Hi Vittorio,

No, nothing should be changing. I wonder if it is something as simple as the names of the chromosomes in the fasta file not matching the names of the chromosomes in the gff3 scaffold file? I sometimes see people calling the chromosome "chr1" in one file and "1" in the other.

Lincoln

On Mon, Nov 22, 2010 at 4:01 PM, Vittorio Zamboni <zamboni-GmumKkuqH9HLh8VA7Ubq0UB+6BGkLq7r@public.gmane.org> wrote:
Yes, I have other 2 only-dna databases (for other species), and they work good.
I have created them with a previous version of GBrowse (I can't remember which, maybe the 1.995).
There is something different in the bp_seqfeature_load.pl file (that is the one I use)?
Sent: Monday, November 22, 2010 9:57:31 PM
Subject: Re: [Gmod-gbrowse] DNA features not loading

Odd. It should work fine. Do you have other databases defined as well?


Lincoln


On Mon, Nov 22, 2010 at 3:52 PM, Vittorio Zamboni < zamboni-GmumKkuqH9HLh8VA7Ubq0UB+6BGkLq7r@public.gmane.org > wrote:


Hi Lincoln,
this is the query result:

id;offset;substring
1;0;"ACCCTAAACCCTAAACCCTA"
1;2000;"TTGCAAGAAGGTATGTTGAT"
1;4000;"TGATGATGATGTAAGGTTAA"
1;6000;"TAGTTGGCAATTAGTTGAAA"
1;8000;"TTATTTGACTCACAGACTAC"
1;10000;"ATATTGAAGGTGTCTCTTCA"
1;12000;"TTTTGCTTATAAAAAATGGA"
1;14000;"TTGCCTTCCCGAATCCCCAT"
1;16000;"CATATACTATGCGATATATA"
1;18000;"AATTTATCCTCAAAAAACCT"

Maybe am I missing something in the GBrowse.conf global config file or in the "local" one? Something like a needed plugin or driver or similar...

Vittorio





----- Original Message -----
From: "Lincoln Stein" < lincoln.stein-Re5JQEeQqe8AvxtiuMwx3w@public.gmane.org >
To: "Vittorio Zamboni" < zamboni-GmumKkuqH9HLh8VA7Ubq0UB+6BGkLq7r@public.gmane.org >
Cc: gmod-gbrowse-5NWGOfrQmneRv+LV9MX5uipxlwaOVQ5f@public.gmane.org
Sent: Monday, November 22, 2010 9:41:13 PM
Subject: Re: [Gmod-gbrowse] DNA features not loading

Hi Vittorio,


To sort this out, could you confirm that the DNA is being loaded into the database successfully? The way to do this is to run the following SQL command from the PSQL interactive command line:





mysql> select id,offset,substring(sequence,1,20) from sequence limit 10;

You should see something like this:





+----+--------+--------------------------+
| id | offset | substring(sequence,1,20) |
+----+--------+--------------------------+
| 1 | 0 | CCACACCACACCCACACACC |
| 1 | 2000 | GGGCGGCTTGGAACATGTAG |
| 1 | 4000 | TTATGATGTTTCAAGGCCTG |
| 1 | 6000 | ATCAATATACTTCTGAGACG |
| 1 | 8000 | CCTAATTTCATCATCAGTTA |
| 1 | 10000 | AGAATGAATCGGATATACTA |
| 1 | 12000 | ATAGACCGTAACAACATCAT |
| 1 | 14000 | ACGTTGTTGAATTCAGTAAT |
| 1 | 16000 | AAACATTGTTGTTTGAATGC |
| 1 | 18000 | AGCCAAATGATGATATCTCT |
+----+--------+--------------------------+
10 rows in set (0.00 sec)


Lincoln


On Tue, Nov 16, 2010 at 2:14 AM, Vittorio Zamboni < zamboni-GmumKkuqH9HLh8VA7Ubq0UB+6BGkLq7r@public.gmane.org > wrote:



Hello,


I am in trouble with features such as GC content and Translations. I loaded a gff3 and a fasta files, with the following structure (with tab instead of spaces):
[gff]
scaffold_1 fasta chromosome 1 245562 . . . ID=scaffold_1;Name=scaffold_1
scaffold_10 fasta chromosome 1 153369 . . . ID=scaffold_10;Name=scaffold_10
[fasta]
>scaffold_1
ATGCGGG.........
>scaffold_10
ATGCGGG.........
Reading some messages in this list, I loaded the gff3 file before the fasta one. The problem occured for the first time when I loaded the files after install GBrowse 2.14 in a (clean) CentOS machine.
Previously I loaded the same files with an old version of GBrowse (1.995) and all went well.
I check the database permissions and all is ok (I am using a PGSQL server):
[scaffolds:database]
db_adaptor = Bio::DB::SeqFeature::Store
db_args = -adaptor DBI::Pg
-dsn dbi:Pg:dbname=c5_genome_fasta;host=genome_server
-user user
-pass user
and the GC track config section is:
[GC]
axis_color = blue
database = scaffolds
description = 0
do_gc = 1
fgcolor = red
gc_window = auto
glyph = dna
height = 40
key = DNA/GC Content


Unfortunately, there are no error messages in the httpd log.
------------------------------------------------------------------------------
Beautiful is writing same markup. Internet Explorer 9 supports
standards for HTML5, CSS3, SVG 1.1, ECMAScript5, and DOM L2 & L3.
Spend less time writing and rewriting code and more time creating great
experiences on the web. Be a part of the beta today
http://p.sf.net/sfu/msIE9-sfdev2dev
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse-5NWGOfrQmneRv+LV9MX5uipxlwaOVQ5f@public.gmane.org
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse




--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa < Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org >



--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa < Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org >



--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org>

------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Scott Cain | 1 Feb 2011 14:39
Favicon

http://localhost/gbrowse2/)

Hi Sharat,

The Math::BigInt messages can be ignored.  The one that is a real
problem is the one about MySQL:

DBI connect('gbrowse_login;user=gbrowse;password=gbrowse','',...)
failed: Can't connect to local MySQL server through socket
'/var/lib/mysql/mysql.sock'

Is MySQL running?
Is there a user named "gbrowse" with a password "gbrowse"?
Do you have GBrowse configured to allow user accounts (user accounts =
0 in GBrowse.conf) (if so, you may want to turn that off for the
tutorial)?
Were you able to do anything with the tutorial?
Are you able to see the yeast demo site that comes with GBrowse?

That should get us started :-)

Scott

On Mon, Jan 31, 2011 at 2:02 AM, Sharat Chandra
<sharat.chndr@...> wrote:
> Dear Sir
>
> This is Sharat chandra, i am working on chick pea genome sequencing project.
> My part is related to the annotation, i.e., i am working on GBrowse and
> trying some tutorial.
>
> Now I can run "http://localhost/gbrowse2/ " easily but after clicking on
> othe pages
> I am not able to get access. found error massage INTERNAL SERVER ERROR.
> In the error log i found
>
> [Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt: couldn't load
> specified math lib(s), fallback to Math::BigInt::FastCalc at
> /usr/local/share/perl5/Crypt/DH.pm line 6, referer:
> http://localhost/gbrowse2/tutorial/tutorial.html
> [Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt: couldn't load
> specified math lib(s), fallback to Math::BigInt::FastCalc at
> /usr/local/share/perl5/Crypt/DH.pm line 6, referer:
> http://localhost/gbrowse2/tutorial/tutorial.html
> [Mon Jan 31 12:03:16 2011] [error] [client ::1] DBI
> connect('gbrowse_login;user=gbrowse;password=gbrowse','',...) failed: Can't
> connect to local MySQL server through socket '/var/lib/mysql/mysql.sock' (2)
> at /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm line
> 21, referer: http://localhost/gbrowse2/tutorial/tutorial.html
> [Mon Jan 31 12:03:16 2011] [error] [client ::1] Undefined subroutine
> &Bio::Graphics::Browser2::UserTracks::Database::header called at
> /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm line
> 23., referer: http://localhost/gbrowse2/tutorial/tutorial.html
> [Mon Jan 31 12:03:16 2011] [error] [client ::1] Premature end of script
> headers: gbrowse, referer: http://localhost/gbrowse2/tutorial/tutorial.html
>
> which type of changes I need to do, so i will able to reach the solution.
> Please help.
>
> Sharat Chandra
> Technical Assistent
> Nipgr,
> New Delhi
>
> ------------------------------------------------------------------------------
> Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
> Finally, a world-class log management solution at an even better price-free!
> Download using promo code Free_Logger_4_Dev2Dev. Offer expires
> February 28th, so secure your free ArcSight Logger TODAY!
> http://p.sf.net/sfu/arcsight-sfd2d
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

--

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
Scott Cain | 1 Feb 2011 16:08
Favicon

http://localhost/gbrowse2/)

Hi Sharat,

Please keep your responses on the mailing list.

I don't understand your question about turning it off.  Turn what off?

Scott

On Tue, Feb 1, 2011 at 9:52 AM, Sharat Chandra
<sharat.chndr@...> wrote:
> Hi Scott,
> Thank u for reply,
> Just before your mail had come, the problen related to the mysql was solved.
> It now showing all demo pages after http://localhost/gbrowse2/.
> But yes, I did the change in the GBrowse.conf in user_accounts= (from 1 to
> 0),
> also tried for the Basic tutorial all are now looks, ok.
> But how can i do it turn off.
> Dose it effect the tutorial step process or when I start my main work?
> Best Regards
> Sharat Chandra
> Technical Assistent
> Nipgr,
> New Delhi
> On Tue, Feb 1, 2011 at 7:09 PM, Scott Cain <scott@...> wrote:
>>
>> Hi Sharat,
>>
>> The Math::BigInt messages can be ignored.  The one that is a real
>> problem is the one about MySQL:
>>
>> DBI connect('gbrowse_login;user=gbrowse;password=gbrowse','',...)
>> failed: Can't connect to local MySQL server through socket
>> '/var/lib/mysql/mysql.sock'
>>
>> Is MySQL running?
>> Is there a user named "gbrowse" with a password "gbrowse"?
>> Do you have GBrowse configured to allow user accounts (user accounts =
>> 0 in GBrowse.conf) (if so, you may want to turn that off for the
>> tutorial)?
>> Were you able to do anything with the tutorial?
>> Are you able to see the yeast demo site that comes with GBrowse?
>>
>> That should get us started :-)
>>
>> Scott
>>
>>
>> On Mon, Jan 31, 2011 at 2:02 AM, Sharat Chandra <sharat.chndr@...>
>> wrote:
>> > Dear Sir
>> >
>> > This is Sharat chandra, i am working on chick pea genome sequencing
>> > project.
>> > My part is related to the annotation, i.e., i am working on GBrowse and
>> > trying some tutorial.
>> >
>> > Now I can run "http://localhost/gbrowse2/ " easily but after clicking on
>> > othe pages
>> > I am not able to get access. found error massage INTERNAL SERVER ERROR.
>> > In the error log i found
>> >
>> > [Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt: couldn't
>> > load
>> > specified math lib(s), fallback to Math::BigInt::FastCalc at
>> > /usr/local/share/perl5/Crypt/DH.pm line 6, referer:
>> > http://localhost/gbrowse2/tutorial/tutorial.html
>> > [Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt: couldn't
>> > load
>> > specified math lib(s), fallback to Math::BigInt::FastCalc at
>> > /usr/local/share/perl5/Crypt/DH.pm line 6, referer:
>> > http://localhost/gbrowse2/tutorial/tutorial.html
>> > [Mon Jan 31 12:03:16 2011] [error] [client ::1] DBI
>> > connect('gbrowse_login;user=gbrowse;password=gbrowse','',...) failed:
>> > Can't
>> > connect to local MySQL server through socket '/var/lib/mysql/mysql.sock'
>> > (2)
>> > at /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm
>> > line
>> > 21, referer: http://localhost/gbrowse2/tutorial/tutorial.html
>> > [Mon Jan 31 12:03:16 2011] [error] [client ::1] Undefined subroutine
>> > &Bio::Graphics::Browser2::UserTracks::Database::header called at
>> > /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm line
>> > 23., referer: http://localhost/gbrowse2/tutorial/tutorial.html
>> > [Mon Jan 31 12:03:16 2011] [error] [client ::1] Premature end of script
>> > headers: gbrowse, referer:
>> > http://localhost/gbrowse2/tutorial/tutorial.html
>> >
>> > which type of changes I need to do, so i will able to reach the
>> > solution.
>> > Please help.
>> >
>> > Sharat Chandra
>> > Technical Assistent
>> > Nipgr,
>> > New Delhi
>> >
>> >
>> > ------------------------------------------------------------------------------
>> > Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
>> > Finally, a world-class log management solution at an even better
>> > price-free!
>> > Download using promo code Free_Logger_4_Dev2Dev. Offer expires
>> > February 28th, so secure your free ArcSight Logger TODAY!
>> > http://p.sf.net/sfu/arcsight-sfd2d
>> > _______________________________________________
>> > Gmod-gbrowse mailing list
>> > Gmod-gbrowse@...
>> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>> >
>> >
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D.                                   scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>> Ontario Institute for Cancer Research
>
>

--

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
Scott Cain | 1 Feb 2011 16:16
Favicon

Re: Problem with Region Selection in 2.23

Hi Karthik,

The dotted lines are to indicate the region where the "details
multiplier" is in effect.  This makes scrolling around the
neighborhood you are looking at instantaneous.  To see how this works,
zoom in a little bit (there is a bug related to this that has been
fixed, see below) so that you don't see that error message anymore and
"grab" the bar in the overview that is inside the dotted lines, and
move it around inside the lines.  See how nicely it scrolls!  You can
also scroll by grabbing anywhere in the details panel that there isn't
a feature and moving the mouse left or right.

About the bug: I believe it's been fixed in the current release (2.24,
with 2.25 probably coming out soon).

Scott

On Mon, Jan 31, 2011 at 1:57 PM, Karthik <mkarthik@...> wrote:
>
> Hello
> I have been getting a strange problem with region selection from version
> 2.21.
>
> http://generic-model-organism-system-database.450254.n5.nabble.com/file/n3365036/gbrowse2.21_error.bmp
>
> In the above figure, the selected region in the region panel is highlighted
> in pink, and the corresponding region is shown in the details panel.
> But, there is also a  region marked by "DOTTED LINES". May I know the
> purpose of those ?
> What I'm seeing is the region marked by the dotted lines is taken as the
> selected segment in Render.pm, and hence it gives the error ""Detailed view
> is limited to 5MB". If the selected segment had been the region highlighted
> in pink, there would not be a problem.
>
> Is there a configuration setting for this problem that I'm not aware of ?
>
> Thanks
> Karthik
> --
> View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/Problem-with-Region-Selection-in-2-23-tp3365036p3365036.html
> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
>
> ------------------------------------------------------------------------------
> Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
> Finally, a world-class log management solution at an even better price-free!
> Download using promo code Free_Logger_4_Dev2Dev. Offer expires
> February 28th, so secure your free ArcSight Logger TODAY!
> http://p.sf.net/sfu/arcsight-sfd2d
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>

--

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
Scott Cain | 1 Feb 2011 17:27
Favicon

http://localhost/gbrowse2/)

Hi Sharat,

Please keep the gbrowse mailing list cc'ed (ie, reply to all).

You don't need user accounts for anything--you can leave it off
forever if you don't want them.  For more information on user
accounts, see:

  http://gmod.org/wiki/GBrowse_User_Database

Scott

On Tue, Feb 1, 2011 at 11:04 AM, Sharat Chandra
<sharat.chndr@...> wrote:
> Hi
> Here I am asking about the user accounts in the GBrowse.conf.
> where its need to turn off for tutorial only or for the some thing else.
> Sharat Chandra
> Technical Assistent
> Nipgr,
> New Delhi
>
> On Tue, Feb 1, 2011 at 8:38 PM, Scott Cain <scott@...> wrote:
>>
>> Hi Sharat,
>>
>> Please keep your responses on the mailing list.
>>
>> I don't understand your question about turning it off.  Turn what off?
>>
>> Scott
>>
>>
>> On Tue, Feb 1, 2011 at 9:52 AM, Sharat Chandra <sharat.chndr@...>
>> wrote:
>> > Hi Scott,
>> > Thank u for reply,
>> > Just before your mail had come, the problen related to the mysql was
>> > solved.
>> > It now showing all demo pages after http://localhost/gbrowse2/.
>> > But yes, I did the change in the GBrowse.conf in user_accounts= (from 1
>> > to
>> > 0),
>> > also tried for the Basic tutorial all are now looks, ok.
>> > But how can i do it turn off.
>> > Dose it effect the tutorial step process or when I start my main work?
>> > Best Regards
>> > Sharat Chandra
>> > Technical Assistent
>> > Nipgr,
>> > New Delhi
>> > On Tue, Feb 1, 2011 at 7:09 PM, Scott Cain <scott@...> wrote:
>> >>
>> >> Hi Sharat,
>> >>
>> >> The Math::BigInt messages can be ignored.  The one that is a real
>> >> problem is the one about MySQL:
>> >>
>> >> DBI connect('gbrowse_login;user=gbrowse;password=gbrowse','',...)
>> >> failed: Can't connect to local MySQL server through socket
>> >> '/var/lib/mysql/mysql.sock'
>> >>
>> >> Is MySQL running?
>> >> Is there a user named "gbrowse" with a password "gbrowse"?
>> >> Do you have GBrowse configured to allow user accounts (user accounts =
>> >> 0 in GBrowse.conf) (if so, you may want to turn that off for the
>> >> tutorial)?
>> >> Were you able to do anything with the tutorial?
>> >> Are you able to see the yeast demo site that comes with GBrowse?
>> >>
>> >> That should get us started :-)
>> >>
>> >> Scott
>> >>
>> >>
>> >> On Mon, Jan 31, 2011 at 2:02 AM, Sharat Chandra
>> >> <sharat.chndr@...>
>> >> wrote:
>> >> > Dear Sir
>> >> >
>> >> > This is Sharat chandra, i am working on chick pea genome sequencing
>> >> > project.
>> >> > My part is related to the annotation, i.e., i am working on GBrowse
>> >> > and
>> >> > trying some tutorial.
>> >> >
>> >> > Now I can run "http://localhost/gbrowse2/ " easily but after clicking
>> >> > on
>> >> > othe pages
>> >> > I am not able to get access. found error massage INTERNAL SERVER
>> >> > ERROR.
>> >> > In the error log i found
>> >> >
>> >> > [Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt:
>> >> > couldn't
>> >> > load
>> >> > specified math lib(s), fallback to Math::BigInt::FastCalc at
>> >> > /usr/local/share/perl5/Crypt/DH.pm line 6, referer:
>> >> > http://localhost/gbrowse2/tutorial/tutorial.html
>> >> > [Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt:
>> >> > couldn't
>> >> > load
>> >> > specified math lib(s), fallback to Math::BigInt::FastCalc at
>> >> > /usr/local/share/perl5/Crypt/DH.pm line 6, referer:
>> >> > http://localhost/gbrowse2/tutorial/tutorial.html
>> >> > [Mon Jan 31 12:03:16 2011] [error] [client ::1] DBI
>> >> > connect('gbrowse_login;user=gbrowse;password=gbrowse','',...) failed:
>> >> > Can't
>> >> > connect to local MySQL server through socket
>> >> > '/var/lib/mysql/mysql.sock'
>> >> > (2)
>> >> > at
>> >> > /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm
>> >> > line
>> >> > 21, referer: http://localhost/gbrowse2/tutorial/tutorial.html
>> >> > [Mon Jan 31 12:03:16 2011] [error] [client ::1] Undefined subroutine
>> >> > &Bio::Graphics::Browser2::UserTracks::Database::header called at
>> >> > /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm
>> >> > line
>> >> > 23., referer: http://localhost/gbrowse2/tutorial/tutorial.html
>> >> > [Mon Jan 31 12:03:16 2011] [error] [client ::1] Premature end of
>> >> > script
>> >> > headers: gbrowse, referer:
>> >> > http://localhost/gbrowse2/tutorial/tutorial.html
>> >> >
>> >> > which type of changes I need to do, so i will able to reach the
>> >> > solution.
>> >> > Please help.
>> >> >
>> >> > Sharat Chandra
>> >> > Technical Assistent
>> >> > Nipgr,
>> >> > New Delhi
>> >> >
>> >> >
>> >> >
>> >> > ------------------------------------------------------------------------------
>> >> > Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
>> >> > Finally, a world-class log management solution at an even better
>> >> > price-free!
>> >> > Download using promo code Free_Logger_4_Dev2Dev. Offer expires
>> >> > February 28th, so secure your free ArcSight Logger TODAY!
>> >> > http://p.sf.net/sfu/arcsight-sfd2d
>> >> > _______________________________________________
>> >> > Gmod-gbrowse mailing list
>> >> > Gmod-gbrowse@...
>> >> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>> >> >
>> >> >
>> >>
>> >>
>> >>
>> >> --
>> >>
>> >> ------------------------------------------------------------------------
>> >> Scott Cain, Ph. D.                                   scott at scottcain
>> >> dot net
>> >> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>> >> Ontario Institute for Cancer Research
>> >
>> >
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D.                                   scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>> Ontario Institute for Cancer Research
>
>

--

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
Lincoln Stein | 1 Feb 2011 17:38
Picon
Gravatar

http://localhost/gbrowse2/)

Hi Sharat,


All your errors relate to the user account feature. I'm not sure why GBrowse installed itself without correctly configuring the database and I would like to have a look at a copy of the messages you saw during the install process.

For now, you can get the browser going without user accounts by setting "user accounts = 0" in /etc/gbrowse2/GBrowse.conf and reloading.

Lincoln

On Mon, Jan 31, 2011 at 2:02 AM, Sharat Chandra <sharat.chndr-Re5JQEeQqe8AvxtiuMwx3w@public.gmane.org> wrote:
Dear Sir

This is Sharat chandra, i am working on chick pea genome sequencing project.
My part is related to the annotation, i.e., i am working on GBrowse and trying some tutorial.

Now I can run "http://localhost/gbrowse2/ " easily but after clicking on othe pages
I am not able to get access. found error massage INTERNAL SERVER ERROR.
In the error log i found

[Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt: couldn't load specified math lib(s), fallback to Math::BigInt::FastCalc at /usr/local/share/perl5/Crypt/DH.pm line 6, referer: http://localhost/gbrowse2/tutorial/tutorial.html
[Mon Jan 31 12:03:15 2011] [error] [client ::1] Math::BigInt: couldn't load specified math lib(s), fallback to Math::BigInt::FastCalc at /usr/local/share/perl5/Crypt/DH.pm line 6, referer: http://localhost/gbrowse2/tutorial/tutorial.html
[Mon Jan 31 12:03:16 2011] [error] [client ::1] DBI connect('gbrowse_login;user=gbrowse;password=gbrowse','',...) failed: Can't connect to local MySQL server through socket '/var/lib/mysql/mysql.sock' (2) at /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm line 21, referer: http://localhost/gbrowse2/tutorial/tutorial.html
[Mon Jan 31 12:03:16 2011] [error] [client ::1] Undefined subroutine &Bio::Graphics::Browser2::UserTracks::Database::header called at /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserTracks/Database.pm line 23., referer: http://localhost/gbrowse2/tutorial/tutorial.html
[Mon Jan 31 12:03:16 2011] [error] [client ::1] Premature end of script headers: gbrowse, referer: http://localhost/gbrowse2/tutorial/tutorial.html

which type of changes I need to do, so i will able to reach the solution.
Please help.

Sharat Chandra
Technical Assistent
Nipgr,
New Delhi

------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires
February 28th, so secure your free ArcSight Logger TODAY!
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse-5NWGOfrQmnc@public.gmane.orgurceforge.net
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse




--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org>
------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Lincoln Stein | 1 Feb 2011 17:40
Picon
Gravatar

Re: GBrowse 2.23 released

I put in code to avoid sudo'ing when not necessary, but this will be a rare occurrence!


Lincoln

On Mon, Jan 31, 2011 at 2:56 PM, Todd Harris <toddwharris-Re5JQEeQqe8AvxtiuMwx3w@public.gmane.org> wrote:
Hi Lincoln -

Thanks for the explanation.

In light of it, I think I would keep the installer as-is.  At least in
my case, apache is usually running as a user like www-data or nobody.

Todd

On Mon, Jan 31, 2011 at 11:28 AM, Lincoln Stein <lincoln.stein-Re5JQEeQqe8AvxtiuMwx3w@public.gmane.org> wrote:
> Hi Todd, Keiran,
> I'm working on the problem with the "empty Bio::Graphics::FeatureFile base"
> now. The issue is that gbrowse_metadb_config.pl isn't being passed the
> prefix when it is invoked. This ought to be an easy fix and will be in 2.25.
> Here is the scoop on why gbrowse_metadb_config.pl requests root privileges.
> Among the various things this script does is to create the user accounts
> database and to fix directory permissions so that uploads and upload sharing
> works properly. Both the database (in the case of using SQLite) and the
> directories need to be writable by the web user in order for things to work
> properly. So the installer requests root privileges in order to set
> ownership. For a non-privileged install I can deactivate all this, but I
> will have to assume that Apache is running under the same user as the person
> who is installing GBrowse. Do you think this is an acceptable condition?
> Lincoln
>
> On Mon, Jan 31, 2011 at 12:24 PM, Todd Harris <toddwharris-Re5JQEeQqe8AvxtiuMwx3w@public.gmane.org> wrote:
>>
>> Hi Keiran -
>>
>> Yes, I've noticed this same problem building against a local perl and
>> installing into a non-privileged path. I resolved in the same manner
>> as you.
>>
>> To simplify installation and avoid library conflicts, we maintain all
>> of our gbrowse installations and prerequisites in local paths.  This
>> works well but I've also been a little unsettled when the GBrowse
>> installer requests root privileges.
>>
>> I wonder if it might be cleaner to assume a non-privileged, non-system
>> install, loading into system paths only if requested.
>>
>> Todd
>>
>> On Mon, Jan 31, 2011 at 6:50 AM, Keiran Raine <kr2-5fLPn3lgkryFxr2TtlUqVg@public.gmane.org> wrote:
>> > Hi all,
>> > Just something to note for anyone not using the default system version
>> > of
>> > perl for their gbrowse setup (normally occurs when you have a site wide
>> > perl
>> > version), e.g.:
>> > ~: perl -v
>> > This is perl, v5.8.8 built for x86_64-linux-thread-multi....
>> > ~: /usr/bin/perl -v
>> > This is perl, v5.10.0 built for x86_64-linux-gnu-thread-multi....
>> > As we don't have 5.10 as our default perl I run the installation
>> > manually as
>> > follows:
>> > /usr/bin/perl Build.PL --prefix /gbrowse
>> > ./Build
>> > ./Build test
>> > ./Build install
>> > Which results in the following failure when the gbrowse_metadb_config.pl
>> > script tries to execute:
>> > Updating user account database...
>> > Base class package "Bio::Graphics::FeatureFile" is empty.
>> >     (Perhaps you need to 'use' the module which defines that package
>> > first.)
>> >  at
>> >
>> > /var/tmp/kr2/GBrowse-2.23/bin/../lib/Bio/Graphics/Browser2/AuthorizedFeatureFile.pm
>> > line 5
>> > BEGIN failed--compilation aborted at
>> >
>> > /var/tmp/kr2/GBrowse-2.23/bin/../lib/Bio/Graphics/Browser2/AuthorizedFeatureFile.pm
>> > line 5.
>> > Compilation failed in require at (eval 5) line 3.
>> > ...propagated at /software/perl-5.8.8/lib/5.8.8/base.pm line 85.
>> > BEGIN failed--compilation aborted at
>> > /var/tmp/kr2/GBrowse-2.23/bin/../lib/Bio/Graphics/Browser2.pm line 9.
>> > Compilation failed in require at bin/gbrowse_metadb_config.pl line 6.
>> > BEGIN failed--compilation aborted at bin/gbrowse_metadb_config.pl line
>> > 6.
>> > If I just ran this manually with the pathed perl I use at the beginning
>> > of
>> > the install process it woks fine:
>> > /usr/bin/perl -c bin/gbrowse_metadb_config.pl
>> > bin/gbrowse_metadb_config.pl syntax OK
>> > Hope this is of use to anyone having issues.
>> > Regards,
>> > Keiran Raine
>> > Senior Computer Biologist
>> > The Cancer Genome Project
>> > Ext: 7703
>> > kr2-5fLPn3lgkryFxr2TtlUqVg@public.gmane.org
>> >
>> >
>> >
>> >
>> > On 30 Jan 2011, at 20:22, Lincoln Stein wrote:
>> >
>> > Hi All,
>> > I have just released GBrowse 2.23 to
>> > CPAN http://search.cpan.org/~lds/GBrowse-2.23/ and Ssourceforge
>> >
>> > (http://sourceforge.net/projects/gmod/files/Generic%20Genome%20Browser/GBrowse-2.23/GBrowse-2.23.tar.gz/download).
>> > IMPORTANT: This release corrects a security issue in which the default
>> > users.sqlite user account database could be created in the root
>> > directory
>> > under some circumstances. If you installed versions 2.20-2.22, please
>> > check
>> > for the presence of /users.sqlite and delete it if it is present. Also
>> > check
>> > the ownership of /, because the install process may have set it to
>> > www-data.
>> > This release also corrects some of the "session lock timeout" issues
>> > that
>> > people have been experiencing. Note, however, that certain long
>> > operations,
>> > such as file uploads, will continue to create timeouts for individual
>> > users;
>> > these are usually safe to ignore. Finally, the bug in which the account
>> > "Registration" link is missing has been fixed.
>> > Here are the complete release notes:
>> >
>> > Version 2.23 (bugfix release)
>> >    * SECURITY ISSUE: Fixed default SQLite user account database to be
>> > created in /var/www/gbrowse2/databases rather
>> >      than in / (root) directory.
>> >    * Added an "example_scripts" directory that contains a perl scripts
>> > that
>> > show how to manipulate
>> >      sessions, upload custom tracks, and get basic information about
>> > services. This directory accompanies
>> >      new REST API documentation located at
>> > http://gmod.oicr.on.ca/wiki/GBrowse2_REST_API.
>> >    * Fixed missing "registration" link in login dialog. This occurred
>> > when
>> > openid was unavailable.
>> >    * Fixed popup dialogs in the "Help" menu so that they appear again.
>> >    * Fixed file upload status display to prevent upload details section
>> > from
>> > disappearing when
>> >      uploading very small files.
>> >    * Tinkered with session settings to minimize session lock timeouts.
>> >    * Removed some dangling warnings in the track sharing module.
>> >    * Made SQLite the default user account database.
>> >
>> > Lincoln
>> >
>> > --
>> > Lincoln D. Stein
>> > Director, Informatics and Biocomputing Platform
>> > Ontario Institute for Cancer Research
>> > 101 College St., Suite 800
>> > Toronto, ON, Canada M5G0A3
>> > 416 673-8514
>> > Assistant: Renata Musa <Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org>
>> >
>> > ------------------------------------------------------------------------------
>> > Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
>> > Finally, a world-class log management solution at an even better
>> > price-free!
>> > Download using promo code Free_Logger_4_Dev2Dev. Offer expires
>> > February 28th, so secure your free ArcSight Logger TODAY!
>> >
>> > http://p.sf.net/sfu/arcsight-sfd2d_______________________________________________
>> > Gmod-gbrowse mailing list
>> > Gmod-gbrowse-5NWGOfrQmneRv+LV9MX5uipxlwaOVQ5f@public.gmane.org
>> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>> >
>> >
>> > -- The Wellcome Trust Sanger Institute is operated by Genome Research
>> > Limited, a charity registered in England with number 1021457 and a compa
>> > ny
>> > registered in England with number 2742969, whose registered office is 2
>> > 15
>> > Euston Road, London, NW1 2BE.
>> >
>> >
>> > ------------------------------------------------------------------------------
>> > Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
>> > Finally, a world-class log management solution at an even better
>> > price-free!
>> > Download using promo code Free_Logger_4_Dev2Dev. Offer expires
>> > February 28th, so secure your free ArcSight Logger TODAY!
>> > http://p.sf.net/sfu/arcsight-sfd2d
>> > _______________________________________________
>> > Gmod-gbrowse mailing list
>> > Gmod-gbrowse-5NWGOfrQmneRv+LV9MX5uipxlwaOVQ5f@public.gmane.org
>> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>> >
>> >
>
>
>
> --
> Lincoln D. Stein
> Director, Informatics and Biocomputing Platform
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Renata Musa <Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org>
>



--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org>
------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Keiran Raine | 1 Feb 2011 17:49
Picon
Favicon

Re: Trusted remote tracks

Hi Nathan,

Thanks for your suggestion, however despite making in-roads that have  
improved the approach so it can be controlled from the datasource  
config files I can't get this to work.

I've attached a patch which gets all of the relevant data into place  
but it seems that the callbacks are still ignored.

Add the a 'trusted_url' directive to your datasource config file where  
you would also the 'allow remote callbacks' indicator

e.g.
allow remote callbacks = 1
trusted_url = http://someurl.some.where.com/

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 7703
kr2@...

On 27 Jan 2011, at 14:48, Weeks, Nathan wrote:

> I've implemented this on GBrowse 1.x before to allow the use of  
> callbacks for
> bgcolor & fgcolor by adding a parameter to the  
> Bio::Graphics::FeatureFile
> constructor in get_remote_upload() in RemoteSet.pm; e.g.:
>
> Bio::Graphics::FeatureFile->new(
> ...
>        -safe => (index($url, 'http://my.trusted.host/') == 0) ? 1 : 0
> ...
>
> While unsatisfying from an engineering perspective, it is easy to  
> implement, if
> you need a quick solution soon.
>
> I haven't tested this in the GBrowse 2.x version of RemoteSet.pm,  
> but the code
> looks similar.
>
> --
> Nathan Weeks
> USDA-ARS
> SoyBase http://soybase.org
>
> On 27 January 2011 12:06, Keiran Raine <kr2@...> wrote:
> > Hi all,
> >
> > We use remote tracks for several data types in our internal system
> > (and potentially would like to in our public site).  I am aware that
> > Safe::World does not work with later versions of perl however has
> > there been any consideration of adding the ability to add trusted  
> URLs
> > to the configuration files so that glyph and tooltips can be  
> displayed
> > without the need for Safe::World?
> >
> > e.g. in GBrowse.conf
> >
> > trusted_remote_url = http://intweb.sanger.ac.uk/cgi-bin/cancer/cosmic.cgi
> > trusted_remote_url = http://intweb.sanger.ac.uk/cgi-bin/cancer/next_gen.cgi
> > trusted_remote_url = http://intweb.sanger.ac.uk/cgi-bin/cancer/live_results.cgi
> >
> >
> > Obviously this type of functionality should only be used for sources
> > you control.
> >
> > Is this something that could be implemented relatively easily?   
> I'd be
> > happy to test.
> >
> > Regards,
> >
> > Keiran Raine
> > Senior Computer Biologist
> > The Cancer Genome Project
> > Ext: 7703
> > kr2@...
> >
>
>
>

--

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 
------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Lincoln Stein | 1 Feb 2011 18:43
Picon
Gravatar

Re: Trusted remote tracks

Hi Keiran,


Your solution sounds workable. I think it can be implemented pretty easily.

Lincoln

On Tue, Feb 1, 2011 at 11:49 AM, Keiran Raine <kr2-5fLPn3lgkryFxr2TtlUqVg@public.gmane.org> wrote:
Hi Nathan,

Thanks for your suggestion, however despite making in-roads that have improved the approach so it can be controlled from the datasource config files I can't get this to work.

I've attached a patch which gets all of the relevant data into place but it seems that the callbacks are still ignored.

Add the a 'trusted_url' directive to your datasource config file where you would also the 'allow remote callbacks' indicator

e.g.
allow remote callbacks = 1

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 7703


-- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a compa ny registered in England with number 2742969, whose registered office is 2 15 Euston Road, London, NW1 2BE.




On 27 Jan 2011, at 14:48, Weeks, Nathan wrote:

I've implemented this on GBrowse 1.x before to allow the use of callbacks for
bgcolor & fgcolor by adding a parameter to the Bio::Graphics::FeatureFile
constructor in get_remote_upload() in RemoteSet.pm; e.g.:

Bio::Graphics::FeatureFile->new(
...
       -safe => (index($url, 'http://my.trusted.host/') == 0) ? 1 : 0
...

While unsatisfying from an engineering perspective, it is easy to implement, if
you need a quick solution soon.

I haven't tested this in the GBrowse 2.x version of RemoteSet.pm, but the code
looks similar. 

--
Nathan Weeks
USDA-ARS
SoyBase http://soybase.org

On 27 January 2011 12:06, Keiran Raine <kr2-5fLPn3lgkryFxr2TtlUqVg@public.gmane.org> wrote:
> Hi all,
>
> We use remote tracks for several data types in our internal system 
> (and potentially would like to in our public site).  I am aware that 
> Safe::World does not work with later versions of perl however has 
> there been any consideration of adding the ability to add trusted URLs 
> to the configuration files so that glyph and tooltips can be displayed 
> without the need for Safe::World?
>
> e.g. in GBrowse.conf
>
> trusted_remote_url = http://intweb.sanger.ac.uk/cgi-bin/cancer/cosmic.cgi
> trusted_remote_url = http://intweb.sanger.ac.uk/cgi-bin/cancer/next_gen.cgi
> trusted_remote_url = http://intweb.sanger.ac.uk/cgi-bin/cancer/live_results.cgi
>
>
> Obviously this type of functionality should only be used for sources 
> you control.
>
> Is this something that could be implemented relatively easily?  I'd be 
> happy to test.
>
> Regards,
>
> Keiran Raine
> Senior Computer Biologist
> The Cancer Genome Project
> Ext: 7703
> kr2-5fLPn3lgkryFxr2TtlUqVg@public.gmane.org
>




------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires
February 28th, so secure your free ArcSight Logger TODAY!
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse-5NWGOfrQmnc@public.gmane.orgurceforge.net
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse




--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa-O2sQSXo6EZOw5LPnMra/2Q@public.gmane.org>
------------------------------------------------------------------------------
Special Offer-- Download ArcSight Logger for FREE (a $49 USD value)!
Finally, a world-class log management solution at an even better price-free!
Download using promo code Free_Logger_4_Dev2Dev. Offer expires 
February 28th, so secure your free ArcSight Logger TODAY! 
http://p.sf.net/sfu/arcsight-sfd2d
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Gmane