Re: ==> displaying ESTs

Hi Dieter,

What does the configuration look like for the track?  And how did you
load it into the database?

Scott

On Fri, Apr 30, 2010 at 6:51 PM, Dieter Best <dieterbest@...> wrote:
> Hello,
>
> I am trying to display ESTs in gbrowse. I would like to have it
> displayed as 2 or more segments connected by a thin line.
>
> If I load something like the following though, it appears gbrowse
> treats them as 2 separate entities.
>
> Any ideas what I could be doing wrong?
>
> Thanks a lot in advance.
>
> ##gff-version 3
> scaffold00253   VelvetNplusKmer21V3     match_part      80007   80151
>  145     -       0       ID=NODE_129857_length_231_cov_38.320347
> scaffold00253   VelvetNplusKmer21V3     match_part      80379   80487
>  109     -       0       ID=NODE_129857_length_231_cov_38.320347
>
> ------------------------------------------------------------------------------
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...

Re: ==> displaying ESTs

Hello Scott,

the track configuration looks like the following

[VelvetNplusKmer21V3]
feature      = match_part:VelvetNplusKmer21V3
glyph        = segments
height       = 6
fgcolor      = tomato
bgcolor     = tomato
key          = VelvetNplusKmer21V3

I use gmod_bulk_load_gff3.pl to put the gff file into Chado

gmod_bulk_load_gff3.pl --dbname xxx  --organism yyy  --analysis --gff temp.gff

On Fri, Apr 30, 2010 at 7:25 PM, Scott Cain <scott@...> wrote:
> Hi Dieter,
>
> What does the configuration look like for the track?  And how did you
> load it into the database?
>
> Scott
>
>
> On Fri, Apr 30, 2010 at 6:51 PM, Dieter Best <dieterbest@...> wrote:
>> Hello,
>>
>> I am trying to display ESTs in gbrowse. I would like to have it
>> displayed as 2 or more segments connected by a thin line.

Re: ==> displaying ESTs

Hi Dieter,

The fact that it is in Chado is important: You can't use grouping by
IDs in a Chado database.  You have to explicitly make parent and child
features.  So you need on feature of type match or one of it's IS_As
(like cDNA_match) with match_part features that have the match as a
parent.

Scott

On Sat, May 1, 2010 at 7:07 PM, Dieter Best <dieterbest@...> wrote:
> Hello Scott,
>
> the track configuration looks like the following
>
> [VelvetNplusKmer21V3]
> feature      = match_part:VelvetNplusKmer21V3
> glyph        = segments
> height       = 6
> fgcolor      = tomato
> bgcolor     = tomato
> key          = VelvetNplusKmer21V3
>
> I use gmod_bulk_load_gff3.pl to put the gff file into Chado
>
> gmod_bulk_load_gff3.pl --dbname xxx  --organism yyy  --analysis --gff temp.gff
>
>
>
> On Fri, Apr 30, 2010 at 7:25 PM, Scott Cain <scott@...> wrote:

Re: ==> displaying ESTs

Hi Scott,

I thought as much. Is there a tool that does that? I was using
bp_search2gff3.pl to create gff3 files from blasted transcripts, but I
couldn't figure out yet how to create that parent-child relationship,
if that is possible at all with it.

-- Dieter

On Sat, May 1, 2010 at 8:00 PM, Scott Cain <scott@...> wrote:
> Hi Dieter,
>
> The fact that it is in Chado is important: You can't use grouping by
> IDs in a Chado database.  You have to explicitly make parent and child
> features.  So you need on feature of type match or one of it's IS_As
> (like cDNA_match) with match_part features that have the match as a
> parent.
>
> Scott
>
>
> On Sat, May 1, 2010 at 7:07 PM, Dieter Best <dieterbest@...> wrote:
>> Hello Scott,
>>
>> the track configuration looks like the following
>>
>> [VelvetNplusKmer21V3]
>> feature      = match_part:VelvetNplusKmer21V3
>> glyph        = segments
>> height       = 6

Re: ==> displaying ESTs

Dieter,

These are the tools I use for making GFF3 from blast or blat outputs:

For blast outputs in table formats -m9 or -m8, see
http://iubio.bio.indiana.edu/gmod/genogrid/scripts/blast92gff3.pl
e.g.
  cat aphid-daphnia_genes.tblastn | sort -k1,1 | blast92gff2.pl > aphid-daphnia_genes.gff

For psl format from Blat, see this  
http://iubio.bio.indiana.edu/gmod/genogrid/tandy/blat2gff.pl

They solve some problems in bp_search2gff3.pl .. see
http://www.bioperl.org/wiki/Talk:GFF_code_audit

-= Don Gilbert
-- d.gilbert--bioinformatics--indiana-u--bloomington-in-47405
-- gilbertd@...://marmot.bio.indiana.edu/

------------------------------------------------------------------------------

gbrowse_syn help for a unique scale

Hello,

I work in INRA Versailles and I’m using Gbrowse_syn for my studies.

I’d like to visualize conserved regions of three different species. Could
you tell if it is possible to have them with the same scale?

I hope I was clear enough and do not hesitate to contact me if you need more
details.

Best regards,

L.BRIGITTE
--

-- 
View this message in context: http://old.nabble.com/gbrowse_syn-help-for-a-unique-scale-tp28433725p28433725.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse <at> lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: Gmod-gbrowse Digest, Vol 48, Issue 1

Hi, 
I had a problem with the DNA/GC content not being displayed properly. 

This is what I did:

1. downloaded the fasta file from here:
ftp://ftp.ncbi.nlm.nih.gov/genomes/R_norvegicus/CHR_01/rn_ref_chr1.gbk.gz
2. used grep and pattern matches to have the fasta sequence in a separate file.
3. used sed to remove comments until the "head" of my fasta file looked liek this:

>NW_047714
TGGGTTTCTATTGTTCTTCCCACTGTTACAACTGAATGCCTGTGCTATTAGTACAATCGT
ATGGACATCACTATCACCATACTAGTAGTATTATATCTCTACCATTACTCCATTAGTTCT
GTTATTACTTGCACATTTTTCATTTATACCACCTGTAACCAGAGAGCTTTTGATTCTAGA
CAAAATTTTGTGTATATAGACCCTTAATCACCTTGTCCACTGGGGTATAGTTTCTGTTAT
TTTTGCCATTTTATTCTTTAGGAAACTGAGCATTAGAGAGCTTATGCAACCTGCTTAAAA
GACTGAGGCTGGAATTCTAATGCTGTAACTGAAGAACTTATATTTCTCCTAGGGCCCTTG
TGGAGATATATGAGATACATGAATAGAAGATTGGTTGATTGAATAAAATGTGGCTCTTTT
TGAAGTGTCATTTTGATAGGAAATCATAGGGAGGTGAATACTGACGAGGGGAATAAGTGT
GGCAATATAAATCAGGGTTATCGGACAGTCTATTTCTATCAACGTAGAAACCCTTATTTT

4. I then used the bp_seqfeatureload.pl and loaded the fasta file into the database that had the genes gff3
files in it.
5. I added the track:

[DNA]
glyph          = dna
global feature = 1
height         = 40
do_gc          = 1

Re: Gmod-gbrowse Digest, Vol 48, Issue 1

Hi Pushkala,

It looks like the names of your chromosomes in your database don't
match the names in the fasta file.  The screenshot shows that you are
looking at a region of "chr5", but your fasta file has names like
"NW_047714"  They need to be the same for GBrowse figure out that they
go together.

Scott

On Mon, May 3, 2010 at 12:18 PM, Jayaraman, Pushkala <pjayaraman@...> wrote:
> Hi,
> I had a problem with the DNA/GC content not being displayed properly.
>
>
> This is what I did:
>
> 1. downloaded the fasta file from here:
> ftp://ftp.ncbi.nlm.nih.gov/genomes/R_norvegicus/CHR_01/rn_ref_chr1.gbk.gz
> 2. used grep and pattern matches to have the fasta sequence in a separate file.
> 3. used sed to remove comments until the "head" of my fasta file looked liek this:
>
>>NW_047714
> TGGGTTTCTATTGTTCTTCCCACTGTTACAACTGAATGCCTGTGCTATTAGTACAATCGT
> ATGGACATCACTATCACCATACTAGTAGTATTATATCTCTACCATTACTCCATTAGTTCT
> GTTATTACTTGCACATTTTTCATTTATACCACCTGTAACCAGAGAGCTTTTGATTCTAGA
> CAAAATTTTGTGTATATAGACCCTTAATCACCTTGTCCACTGGGGTATAGTTTCTGTTAT
> TTTTGCCATTTTATTCTTTAGGAAACTGAGCATTAGAGAGCTTATGCAACCTGCTTAAAA
> GACTGAGGCTGGAATTCTAATGCTGTAACTGAAGAACTTATATTTCTCCTAGGGCCCTTG
> TGGAGATATATGAGATACATGAATAGAAGATTGGTTGATTGAATAAAATGTGGCTCTTTT

Re: Gmod-gbrowse Digest, Vol 48, Issue 1

------------------------------------------------------------------------------

_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

FW:dna/gc content

-----Original Message-----
From: Jayaraman, Pushkala 
Sent: Monday, May 03, 2010 11:34 AM
To: Scott Cain
Cc: gmod-gbrowse@...
Subject: RE: [Gmod-gbrowse] Gmod-gbrowse Digest, Vol 48, Issue 1

Hi Scott, 

if my gff3 file were like this:
where the header of the fasta file matches the "ID". If this isn't the way to do it, then for a gff3 file like
this, should the header be the feature "Chr1" ? 
I know this may be a repeated question, but if that were the case, how would it know what coordinates to match?

Chr1    GenBank chromosome      17295177        19253295        .       +       .      
ID=NW_047547;Alias=1;Dbxref=taxon:10116;Note=Rattus norvegicus chromosome 1 genomic contig%2C
reference assembly (based on RGSC v3.4).,GENOME ANNOTATION REFSEQ: Features on this sequence have been
produced for build 4 version 1 of the NCBI's genome annotation [see documentation]. The DNA sequence is
version 3.4 'November 2004 Update' of the Rat genome assembly,produced by the Baylor College of Medicine
Human Genome Sequencing Center (BCM- HGSC) as part of the Rat Genome Sequencing Consortium (RGSC). This
supersedes all prior versions of the Rat assembly (2.0,2.1,3.0,3.1 3.2 and 3.3) (see
http://www.hgsc.bcm.tmc.edu/projects/rat/). ;chromosome=1;comment1=GENOME ANNOTATION REFSEQ:
Features on this sequence have been produced for build 4 version 1 of the NCBI's genome annotation [see
documentation]. The DNA sequence is version 3.4 'November 2004 Update' of the Rat genome assembly%2C
produced by the Baylor College of Medicine Human Genome Sequencing Center (BCM- HGSC) as part of the Rat
Genome Sequencing Consortium (RGSC). This supersedes all prior versions of the Rat assembly (2.0%2C
2.1%2C 3.0%2C 3.1 3.2 and 3.3) (see http://www.hgsc.bcm.tmc.edu/projects/rat/).
;date=22-JUN-2006;mol_type=genomic DNA;organism=Rattus norvegicus;strain=BN/SsNHsdMCW;
Chr1    GenBank exon    123057586       123057716       .       +       .       Parent=LOC680906.t01;gene=LOC680906;Dbxref=GeneID:680906,RGD:1585883,GI:109458899;
Chr1    GenBankRGDgene  exon    123057586       123057716       .       +       .       Dbxref=GeneID:680906,RGD:1585883;ID=exon18358;Parent=RGD1585883;gene=LOC680906;Name=LOC680906;
Chr1    GenBank exon    123061579       123061678       .       +       .       Parent=LOC680906.t01;gene=LOC680906;Dbxref=GeneID:680906,RGD:1585883,GI:109458899;
Chr1    GenBankRGDgene  exon    123061579       123061678       .       +       .       Dbxref=GeneID:680906,RGD:1585883;ID=exon18359;Parent=RGD1585883;gene=LOC680906;Name=LOC680906;
Chr1    GenBank exon    123114649       123114691       .       +       .       Parent=LOC680906.t01;gene=LOC680906;Dbxref=GeneID:680906,RGD:1585883,GI:109458899;
Chr1    GenBankRGDgene  exon    123114649       123114691       .       +       .       Dbxref=GeneID:680906,RGD:1585883;ID=exon18360;Parent=RGD1585883;gene=LOC680906;Name=LOC680906;
Chr1    GenBank pseudogene      3595    24944   .       +       .       ID=LOC688504;Dbxref=GeneID:688504;Note=Derived by automated
computational analysis using gene prediction method: GNOMON. Supporting evidence includes
similarity to: 165 ESTs%2C 3 Proteins;gene=LOC688504;pseudo=_no_value;
Chr1    GenBank pseudogene      36020   37359   .       +       .       ID=LOC365518;Dbxref=GeneID:365518;Note=Derived by
automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes
similarity to: 1 mRNA%2C 177 ESTs%2C 6 Proteins;gene=LOC365518;pseudo=_no_value;
Chr1    GenBank pseudogene      47021   50492   .       -       .       ID=LOC688542;Dbxref=GeneID:688542;Note=Derived by
automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes
similarity to: 2 ESTs%2C 14 Proteins;gene=LOC688542;pseudo=_no_value;

Pushkala Jayaraman
Programmer Analyst II
Rat Genome Database
Medical College of Wisconsin, Wauwatosa, WI

-----Original Message-----
From: Scott Cain [mailto:scott@...]
Sent: Mon 5/3/2010 11:31 AM
To: Jayaraman, Pushkala
Cc: gmod-gbrowse@...
Subject: Re: [Gmod-gbrowse] Gmod-gbrowse Digest, Vol 48, Issue 1

Hi Pushkala,

It looks like the names of your chromosomes in your database don't
match the names in the fasta file.  The screenshot shows that you are
looking at a region of "chr5", but your fasta file has names like
"NW_047714"  They need to be the same for GBrowse figure out that they
go together.

Scott

On Mon, May 3, 2010 at 12:18 PM, Jayaraman, Pushkala <pjayaraman@...> wrote:
> Hi,
> I had a problem with the DNA/GC content not being displayed properly.
>
>
> This is what I did:
>
> 1. downloaded the fasta file from here:
> ftp://ftp.ncbi.nlm.nih.gov/genomes/R_norvegicus/CHR_01/rn_ref_chr1.gbk.gz
> 2. used grep and pattern matches to have the fasta sequence in a separate file.
> 3. used sed to remove comments until the "head" of my fasta file looked liek this:
>
>>NW_047714
> TGGGTTTCTATTGTTCTTCCCACTGTTACAACTGAATGCCTGTGCTATTAGTACAATCGT
> ATGGACATCACTATCACCATACTAGTAGTATTATATCTCTACCATTACTCCATTAGTTCT
> GTTATTACTTGCACATTTTTCATTTATACCACCTGTAACCAGAGAGCTTTTGATTCTAGA
> CAAAATTTTGTGTATATAGACCCTTAATCACCTTGTCCACTGGGGTATAGTTTCTGTTAT
> TTTTGCCATTTTATTCTTTAGGAAACTGAGCATTAGAGAGCTTATGCAACCTGCTTAAAA
> GACTGAGGCTGGAATTCTAATGCTGTAACTGAAGAACTTATATTTCTCCTAGGGCCCTTG
> TGGAGATATATGAGATACATGAATAGAAGATTGGTTGATTGAATAAAATGTGGCTCTTTT
> TGAAGTGTCATTTTGATAGGAAATCATAGGGAGGTGAATACTGACGAGGGGAATAAGTGT
> GGCAATATAAATCAGGGTTATCGGACAGTCTATTTCTATCAACGTAGAAACCCTTATTTT
>
>
> 4. I then used the bp_seqfeatureload.pl and loaded the fasta file into the database that had the genes gff3
files in it.
> 5. I added the track:
>
> [DNA]
> glyph          = dna
> global feature = 1
> height         = 40
> do_gc          = 1
> gc_window      = auto
> fgcolor        = red
> axis_color     = blue
> strand         = both
> category       = DNA
> key            = DNA/GC Content
>
> in my .conf file and reloaded the webpage:
> the screenshot of what I see is attached herewith:
>
> I do not see any dna/gc content. where have I gone wrong?
>
>
> Pushkala Jayaraman
> Programmer Analyst II
> Rat Genome Database
> Medical College of Wisconsin, Wauwatosa, WI
>
> ------------------------------------------------------------------------------
>
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

--

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------