weidmao | 23 Oct 02:04 2014

Need help on Installation of GBrowse

I goe the following message when I was running the Build.PL script, is it
normal? Bcause I failed the test after this. ANy comments? Thanks.

Checking prerequisites...
  recommends:
    *  Bio::DB::BigFile is not installed
    *  Bio::DB::Sam is not installed
    *  Bio::Das is not installed
  * Do not worry if some "recommended" prerequisites are missing. You can
install *
  * them later if you need the features they provide. Do not proceed with
the     *
  * install if any of "REQUIRED" prerequisites are missing.                      
*
  *                                                                              
*
  * The optional Safe::World module does not currently run on Perl 5.10 or       
*
  * higher, and so cannot be installed.                                          
*

ERRORS/WARNINGS FOUND IN PREREQUISITES.  You may wish to install the
versions
of the modules indicated above before proceeding with this installation

Run 'Build installdeps' to install missing prerequisites.

**** WARNING
*****************************************************************************************
If you are upgrading from an earlier version of GBrowse and wish to use
(Continue reading)

ThankGod E. Ebenezer | 22 Oct 19:44 2014
Picon
Picon

Re: Uploaded file: The server returned an error during upload [Remove Message]

Dear Scott,

I have now been able to get GBrowse successfully installed. I'm doing the volvox tutorial (http://cloud.gmod.org/gbrowse2/tutorial/tutorial.html), and have gotten to C. elegans part in section 4.1 (Uploading an annotation file). Everything was smooth, until this point where I discovered I can't upload a track per the C. elegans tutorial.

I followed the process, and when I tried to upload the "elegans_acceptor.gff3" file, I get this error message:    Uploaded file The server returned an error during upload [Remove Message]

I have also pasted a screen shot below of the error message whilst trying to upload file.

This is the message from apache2.log:

xxx.x.x.x - - [22/Oct/2014:18:29:07 +0100] "POST /cgi-bin/gb2/gbrowse/eleganc_core/ HTTP/1.1" 200 433 "http://localhost/cgi-bin/gb2/gbrowse/eleganc_core/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
xxx.x.x.x - - [22/Oct/2014:18:29:07 +0100] "POST /cgi-bin/gb2/gbrowse/eleganc_core/ HTTP/1.1" 500 630 "http://localhost/cgi-bin/gb2/gbrowse/eleganc_core/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"

Do you have any suggestion as to what may be wrong, or how I can get this sorted out? A quick check on the web says is normally an apache timeout issue, but the .gff file is 156 bytes, and contains just 2 lines or 2 IDs, and should upload in less that a sec or two.

Also, I can browse the C. elegans database, but I was wondering why the browser points to: /cgi-bin/gb2/gbrowse/eleganc_core/  rather than /cgi-bin/gb2/gbrowse/elegans_core/    is the former the default for the tutorial? I checked my database name, as well as other configurations, and they read /elegans_ and not /eleganc_  

Regards,

ThankGod

Core C. elegans annotations: 40 kbp from C01F4:1..40,000

Browser Select Tracks Snapshots Community Tracks Custom Tracks Preferences

Custom Tracks

[Help with uploading custom tracks]

There are no tracks yet.

Add custom tracks : [>From text] [From a URL] [From a file]

Upload a track file
Uploaded file The server returned an error during upload [Remove Message]
 [Cancel]
 
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Scott Cain | 22 Oct 17:38 2014
Picon

Re: /cgi-bin/ issue - Ubuntu

Hi Alessandro,

Please keep the mailing list cc'ed so other people can help too and the resolution gets archived.

I suspect there is something wrong with your apache config.  The GBrowse installer should have installed an apache config file called gbrowse2.conf.  In Ubuntu 12.04 systems, it would go in /etc/apache2/conf.d/.  I'm not sure if that's where it would have gone in 14.04 since the apache configuration changed somewhat between those releases.  Please verify that that the file is present and then restart apache to make sure it gets included in the configuration.

In that configuration file there should be a section telling apache how to handle the GBrowse cgis in /usr/lib/cgi-bin/gb that looks like this:

<Directory "/usr/lib/cgi-bin/gb2">

  Options ExecCGI
  SetEnv GBROWSE_CONF   "/etc/gbrowse2"
</Directory>

Scott


On Tue, Oct 21, 2014 at 3:45 PM, Alessandro Rossoni <schum1-PkbjNfxxIASELgA04lAiVw@public.gmane.org> wrote:
Hi Scott, 
thank you very much for your quick answer!

I followed the steps described here:

so the command should be 
sudo perl -MCPAN -e 'install Bio::Graphics::Browser2'

I attached two screenshots.

Thanks,
Alessandro


Plant Biochemisty, AG Weber
Heinrich Heine Universitaet Duesseldorf
Germany




Date: Tue, 21 Oct 2014 15:22:02 -0400
Subject: Re: [Gmod-gbrowse] /cgi-bin/ issue - Ubuntu
From: scott-XkniDE3L5z0cWVvVuXF20w@public.gmane.org
To: schum1 <at> hotmail.de


Hi Heinrich,

Can you tell us if you were trying to install via the command line, CPAN shell or apt-get?  If you're trying to use apt-get, can you do an ls -R in your /usr/lib/cgi-bin directory?

Thanks,
Scott


On Tue, Oct 21, 2014 at 2:56 PM, Alessandro Rossoni <schum1-PkbjNfxxIASELgA04lAiVw@public.gmane.org> wrote:
Dear GBrowse support team,
After some days of struggle and searching the internet, I am writing to you about my problem while trying to get GBrowse2 working properly.

I have tried installing GBrowse on Ubuntu 12.04 and 14.04. In both cases I encountered the same issue. I always get the following message:

"The requested URL /cgi-bin/gbrowse2/gbrowse/volvox was not found on this server." (404 Not Found)
or
"The requested URL /cgi-bin/gb2/gbrowse/yeast was not found on this server." (404 Not Found)

However, when a collegue of mine tried to install GBrowse2 on Debian (following the same installation procedure as described in the HOWTOS) everything instantly works. Unfortunately our server works with Ubuntu.

I also attached the apache2 error log, although today (10/21) no new error was reported (and I experimented a lot)

Thanks in advance for your help.
Alessandro Rossoni


Plant Biochemisty, AG Weber
Heinrich Heine Universitaet Duesseldorf
Germany

------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse-5NWGOfrQmneRv+LV9MX5uipxlwaOVQ5f@public.gmane.org
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse




--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research



--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Alessandro Rossoni | 21 Oct 20:56 2014
Picon

/cgi-bin/ issue - Ubuntu

Dear GBrowse support team,
After some days of struggle and searching the internet, I am writing to you about my problem while trying to get GBrowse2 working properly.

I have tried installing GBrowse on Ubuntu 12.04 and 14.04. In both cases I encountered the same issue. I always get the following message:

"The requested URL /cgi-bin/gbrowse2/gbrowse/volvox was not found on this server." (404 Not Found)
or
"The requested URL /cgi-bin/gb2/gbrowse/yeast was not found on this server." (404 Not Found)

However, when a collegue of mine tried to install GBrowse2 on Debian (following the same installation procedure as described in the HOWTOS) everything instantly works. Unfortunately our server works with Ubuntu.

I also attached the apache2 error log, although today (10/21) no new error was reported (and I experimented a lot)

Thanks in advance for your help.
Alessandro Rossoni


Plant Biochemisty, AG Weber
Heinrich Heine Universitaet Duesseldorf
Germany
[Mon Oct 20 23:22:28.836764 2014] [mpm_event:notice] [pid 7357:tid 140029404981120] AH00489:
Apache/2.4.7 (Ubuntu) configured -- resuming normal operations
[Mon Oct 20 23:22:28.836843 2014] [core:notice] [pid 7357:tid 140029404981120] AH00094: Command line: '/usr/sbin/apache2'
[Mon Oct 20 23:22:31.001742 2014] [mpm_event:notice] [pid 7357:tid 140029404981120] AH00491: caught
SIGTERM, shutting down
[Mon Oct 20 23:22:32.049489 2014] [mpm_event:notice] [pid 7517:tid 140449131902848] AH00489:
Apache/2.4.7 (Ubuntu) mod_fcgid/2.3.9 configured -- resuming normal operations
[Mon Oct 20 23:22:32.049561 2014] [core:notice] [pid 7517:tid 140449131902848] AH00094: Command line: '/usr/sbin/apache2'
[Mon Oct 20 23:26:26.357920 2014] [mpm_event:notice] [pid 7517:tid 140449131902848] AH00491: caught
SIGTERM, shutting down
[Mon Oct 20 23:26:27.405138 2014] [mpm_event:notice] [pid 12646:tid 140356297430912] AH00489:
Apache/2.4.7 (Ubuntu) mod_fcgid/2.3.9 configured -- resuming normal operations
[Mon Oct 20 23:26:27.405213 2014] [core:notice] [pid 12646:tid 140356297430912] AH00094: Command
line: '/usr/sbin/apache2'
[Mon Oct 20 23:58:23.500514 2014] [mpm_event:notice] [pid 12646:tid 140356297430912] AH00494: SIGHUP
received.  Attempting to restart
[Mon Oct 20 23:58:23.552022 2014] [mpm_event:notice] [pid 12646:tid 140356297430912] AH00489:
Apache/2.4.7 (Ubuntu) mod_fcgid/2.3.9 configured -- resuming normal operations
[Mon Oct 20 23:58:23.552041 2014] [core:notice] [pid 12646:tid 140356297430912] AH00094: Command
line: '/usr/sbin/apache2'
127.0.0.1 - - [20/Oct/2014:23:29:39 +0200] "GET /gbrowse2 HTTP/1.1" 301 570 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:40 +0200] "GET /gbrowse2/ HTTP/1.1" 200 1822 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:40 +0200] "GET /gbrowse2/tutorial/tutorial.css HTTP/1.1" 200 622
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:40 +0200] "GET /gbrowse2/gmod_cog.jpeg HTTP/1.1" 200 5575
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:41 +0200] "GET /favicon.ico HTTP/1.1" 404 498 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:41 +0200] "GET /favicon.ico HTTP/1.1" 404 498 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:48 +0200] "GET /gb2/gbrowse/yeast HTTP/1.1" 404 505
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/tutorial.html HTTP/1.1" 200
51481 "http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0)
Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/basics1.gif HTTP/1.1"
200 64365 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/basic_conf1.gif
HTTP/1.1" 200 4330 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/basic_conf2.gif
HTTP/1.1" 200 4123 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/descriptions1.gif
HTTP/1.1" 200 7960 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/aliases.gif HTTP/1.1"
200 50078 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET
/gbrowse2/tutorial/figures/segmented_features2.gif HTTP/1.1" 200 13186
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/canonical_gene1.gif
HTTP/1.1" 200 6165 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/canonical_gene3.gif
HTTP/1.1" 200 5169 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET
/gbrowse2/tutorial/figures/custom_aggregators1.gif HTTP/1.1" 200 5000
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/cds1.gif HTTP/1.1" 200
11260 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/graph1.gif HTTP/1.1"
200 10949 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/predicted_genes.gif
HTTP/1.1" 200 6493 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/wiggle_density.png
HTTP/1.1" 200 11101 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/dna1.png HTTP/1.1" 200
17911 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/dna2.png HTTP/1.1" 200
20087 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments1.gif HTTP/1.1" 200 7837
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments2.gif HTTP/1.1" 200 7914
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments3.gif HTTP/1.1" 200 4067
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET
/gbrowse2/tutorial/figures/adding_dna_to_alignments1.gif HTTP/1.1" 200 22569
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/trace1.png HTTP/1.1"
200 7192 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/trace2.png HTTP/1.1"
200 8352 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/overview1.gif
HTTP/1.1" 200 16371 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/semantic_zooming1.gif
HTTP/1.1" 200 3065 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/enhancements3.gif
HTTP/1.1" 200 11597 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/categorytable.png
HTTP/1.1" 200 9592 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/plugins1.gif HTTP/1.1"
200 14619 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/plugins2.gif HTTP/1.1"
200 7987 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/third_party2.gif
HTTP/1.1" 200 34452 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/third_party1.gif
HTTP/1.1" 200 226054 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/setting_popup.png
HTTP/1.1" 200 26457 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/tutorial/figures/config_editing.png
HTTP/1.1" 200 40408 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:29:56 +0200] "GET /gbrowse2/images/buttons/share.png HTTP/1.1" 200
450 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:30:19 +0200] "GET /cgi-bin/gbrowse2/gbrowse/volvox HTTP/1.1" 404 519
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:31:30 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:32:04 +0200] "GET / HTTP/1.1" 200 3594 "-" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:32:04 +0200] "GET /icons/ubuntu-logo.png HTTP/1.1" 200 3688
"http://127.0.1.1/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:32:06 +0200] "GET /favicon.ico HTTP/1.1" 404 498 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:32:06 +0200] "GET /favicon.ico HTTP/1.1" 404 498 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:58:40 +0200] "GET /server-status HTTP/1.0" 200 3566 "-"
"Lynx/2.8.8pre.4 libwww-FM/2.14 SSL-MM/1.4.1 GNUTLS/2.12.23"
127.0.0.1 - - [20/Oct/2014:23:59:28 +0200] "GET / HTTP/1.1" 200 3594 "-" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:59:29 +0200] "GET /icons/ubuntu-logo.png HTTP/1.1" 200 3688
"http://localhost/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [20/Oct/2014:23:59:30 +0200] "GET /favicon.ico HTTP/1.1" 404 498 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:00:00:49 +0200] "GET /gbrowse2/ HTTP/1.1" 200 1823 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:00:00:50 +0200] "GET /gbrowse2/tutorial/tutorial.css HTTP/1.1" 200 622
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:00:00:50 +0200] "GET /gbrowse2/gmod_cog.jpeg HTTP/1.1" 304 180
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:00:00:56 +0200] "GET /gbrowse2/example_scripts HTTP/1.1" 301 602
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:00:00:56 +0200] "GET /gbrowse2/example_scripts/ HTTP/1.1" 200 782
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:00:01:15 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:20 +0200] "GET /favicon.ico HTTP/1.1" 404 499 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/tutorial.html HTTP/1.1" 200
51481 "http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0)
Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/tutorial.css HTTP/1.1" 200 622
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/basics1.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/basic_conf1.gif
HTTP/1.1" 304 179 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/basic_conf2.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/descriptions1.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/aliases.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET
/gbrowse2/tutorial/figures/segmented_features2.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/canonical_gene3.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/canonical_gene1.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/predicted_genes.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/cds1.gif HTTP/1.1" 304
180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET
/gbrowse2/tutorial/figures/custom_aggregators1.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/graph1.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/wiggle_density.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/dna1.png HTTP/1.1" 304
180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/dna2.png HTTP/1.1" 304
180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments2.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments1.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments3.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET
/gbrowse2/tutorial/figures/adding_dna_to_alignments1.gif HTTP/1.1" 304 181
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/trace2.png HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/trace1.png HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/semantic_zooming1.gif
HTTP/1.1" 304 179 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/overview1.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/enhancements3.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/categorytable.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/third_party1.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/plugins1.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/plugins2.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/third_party2.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/setting_popup.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/tutorial/figures/config_editing.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:35 +0200] "GET /gbrowse2/images/buttons/share.png HTTP/1.1" 304
178 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:42 +0200] "GET /gbrowse2/tutorial/data_files/ HTTP/1.1" 200 8398
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:42 +0200] "GET /icons/blank.gif HTTP/1.1" 200 430
"http://localhost/gbrowse2/tutorial/data_files/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:42 +0200] "GET /icons/back.gif HTTP/1.1" 200 499
"http://localhost/gbrowse2/tutorial/data_files/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:42 +0200] "GET /icons/text.gif HTTP/1.1" 200 512
"http://localhost/gbrowse2/tutorial/data_files/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:42 +0200] "GET /icons/unknown.gif HTTP/1.1" 200 527
"http://localhost/gbrowse2/tutorial/data_files/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:50 +0200] "GET /gbrowse2/tutorial/conf_files/ HTTP/1.1" 200 3449
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:24:50 +0200] "GET /icons/script.gif HTTP/1.1" 200 524
"http://localhost/gbrowse2/tutorial/conf_files/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:25:38 +0200] "GET /gbrowse2/tutorial/data_files/ HTTP/1.1" 200 8398
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:25:41 +0200] "GET /gbrowse2/tutorial/data_files/elegans.fa
HTTP/1.1" 200 55772 "http://localhost/gbrowse2/tutorial/data_files/" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:33:32 +0200] "GET /gbrowse2/ HTTP/1.1" 200 1823 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:09:33:32 +0200] "GET /gbrowse2/gmod_cog.jpeg HTTP/1.1" 304 180
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:02:38 +0200] "GET /gbrowse2/ HTTP/1.1" 200 1823 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:02:39 +0200] "GET /gbrowse2/tutorial/tutorial.css HTTP/1.1" 200 622
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:02:39 +0200] "GET /gbrowse2/gmod_cog.jpeg HTTP/1.1" 304 180
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:02:39 +0200] "GET /favicon.ico HTTP/1.1" 404 498 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:05:27 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:06:26 +0200] "GET /cgi-bin/gbrowse//gbrowse HTTP/1.1" 404 512
"http://gmod.827538.n3.nabble.com/The-requested-URL-cgi-bin-gb2-was-not-found-on-this-server-td4037471.html"
"Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:07:53 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://comments.gmane.org/gmane.science.biology.gmod.gbrowse/9221" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:13 +0200] "GET /gbrowse2/tutorial/tutorial.html HTTP/1.1" 200
51481 "http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0)
Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:13 +0200] "GET /gbrowse2/tutorial/figures/basics1.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:13 +0200] "GET /gbrowse2/tutorial/figures/basic_conf1.gif
HTTP/1.1" 304 179 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/descriptions1.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/basic_conf2.gif
HTTP/1.1" 304 179 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET
/gbrowse2/tutorial/figures/segmented_features2.gif HTTP/1.1" 304 181
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/aliases.gif HTTP/1.1"
304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/canonical_gene1.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/canonical_gene3.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/predicted_genes.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/cds1.gif HTTP/1.1" 304
180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET
/gbrowse2/tutorial/figures/custom_aggregators1.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/graph1.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/wiggle_density.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/dna1.png HTTP/1.1" 304
180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/dna2.png HTTP/1.1" 304
180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments1.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments3.gif HTTP/1.1" 304 179
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/trace1.png HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET
/gbrowse2/tutorial/figures/adding_dna_to_alignments1.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments2.gif HTTP/1.1" 304 180
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/trace2.png HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/overview1.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/semantic_zooming1.gif
HTTP/1.1" 304 179 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/enhancements3.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/categorytable.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/plugins1.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/plugins2.gif HTTP/1.1"
304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/third_party1.gif
HTTP/1.1" 304 181 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/third_party2.gif
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/setting_popup.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/tutorial/figures/config_editing.png
HTTP/1.1" 304 180 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:15:14 +0200] "GET /gbrowse2/images/buttons/share.png HTTP/1.1" 304
178 "http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:17:34 +0200] "GET
/gbrowse2/tutorial/data_files/volvox_remarks.gff3 HTTP/1.1" 200 1165
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:26:07 +0200] "GET /cgi-bin/gb2/gbrowse/volvox HTTP/1.1" 404 514
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:31:13 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:32:06 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:19:40:40 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
134.99.200.87 - - [21/Oct/2014:20:02:46 +0200] "GET /gbrowse2/ HTTP/1.1" 200 1823 "-" "Mozilla/5.0
(X11; Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:46 +0200] "GET /gbrowse2/tutorial/tutorial.css HTTP/1.1" 200
622 "http://134.99.200.47/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:32.0)
Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:46 +0200] "GET /gbrowse2/gmod_cog.jpeg HTTP/1.1" 200 5576
"http://134.99.200.47/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:32.0)
Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:46 +0200] "GET /favicon.ico HTTP/1.1" 404 502 "-" "Mozilla/5.0
(X11; Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:47 +0200] "GET /favicon.ico HTTP/1.1" 404 502 "-" "Mozilla/5.0
(X11; Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/tutorial.html HTTP/1.1" 200
51480 "http://134.99.200.47/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:32.0)
Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/basics1.gif
HTTP/1.1" 200 64365 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/basic_conf1.gif
HTTP/1.1" 200 4330 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/basic_conf2.gif
HTTP/1.1" 200 4122 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/aliases.gif
HTTP/1.1" 200 50078 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/descriptions1.gif
HTTP/1.1" 200 7961 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/canonical_gene1.gif HTTP/1.1" 200 6165
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/segmented_features2.gif HTTP/1.1" 200 13186
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/canonical_gene3.gif HTTP/1.1" 200 5168
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/predicted_genes.gif HTTP/1.1" 200 6493
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/cds1.gif HTTP/1.1"
200 11260 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/custom_aggregators1.gif HTTP/1.1" 200 5000
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/graph1.gif
HTTP/1.1" 200 10949 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/wiggle_density.png HTTP/1.1" 200 11101
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/dna1.png HTTP/1.1"
200 17911 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/dna2.png HTTP/1.1"
200 20087 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu;
Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments1.gif HTTP/1.1" 200 7837
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments2.gif HTTP/1.1" 200 7914
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/multiple_alignments3.gif HTTP/1.1" 200 4067
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/adding_dna_to_alignments1.gif HTTP/1.1" 200 22569
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/trace1.png
HTTP/1.1" 200 7192 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/trace2.png
HTTP/1.1" 200 8352 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/overview1.gif
HTTP/1.1" 200 16371 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/semantic_zooming1.gif HTTP/1.1" 200 3065
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/enhancements3.gif
HTTP/1.1" 200 11597 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/categorytable.png
HTTP/1.1" 200 9592 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/plugins1.gif
HTTP/1.1" 200 14619 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/plugins2.gif
HTTP/1.1" 200 7987 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/third_party2.gif
HTTP/1.1" 200 34452 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/setting_popup.png
HTTP/1.1" 200 26457 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET
/gbrowse2/tutorial/figures/config_editing.png HTTP/1.1" 200 40408
"http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/images/buttons/share.png HTTP/1.1"
200 450 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux
x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
134.99.200.87 - - [21/Oct/2014:20:02:48 +0200] "GET /gbrowse2/tutorial/figures/third_party1.gif
HTTP/1.1" 200 226054 "http://134.99.200.47/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:32.0) Gecko/20100101 Firefox/32.0"
127.0.0.1 - - [21/Oct/2014:20:29:55 +0200] "GET /favicon.ico HTTP/1.1" 404 499 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:20:30:09 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:20:40:02 +0200] "GET /favicon.ico HTTP/1.1" 404 499 "-" "Mozilla/5.0 (X11;
Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:20:40:14 +0200] "GET /cgi-bin/gbrowse2/gbrowse/volvox HTTP/1.1" 404 519
"http://localhost/gbrowse2/tutorial/tutorial.html" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64;
rv:33.0) Gecko/20100101 Firefox/33.0"
127.0.0.1 - - [21/Oct/2014:20:42:14 +0200] "GET /cgi-bin/gb2/gbrowse/yeast HTTP/1.1" 404 513
"http://localhost/gbrowse2/" "Mozilla/5.0 (X11; Ubuntu; Linux x86_64; rv:33.0) Gecko/20100101 Firefox/33.0"
------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
John Portwood | 20 Oct 21:21 2014
Picon

Re: vista_plot glyph fails to load

I've resolved the issue now. Turns out I did not have Bio::DB::BigFile
properly installed. Compiling the vista_plot file individually with "perl -c
vista_plot.pm" spat out a more informative error.

Thanks!

--
View this message in context: http://generic-model-organism-system-database.450254.n5.nabble.com/vista-plot-glyph-fails-to-load-tp5712800p5712837.html
Sent from the gmod-gbrowse mailing list archive at Nabble.com.

------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
Lau, Branden M - (bmlau | 20 Oct 19:16 2014
Picon

GFF3 editor?

Hi,

I was wondering if there was any program or tool that can edit a GFF3 file that's not a perl script? For example I have a file where I need to edit the first column in order to append information. 

Thanks,
Branden
------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Jeff Nie | 20 Oct 05:21 2014
Picon

heat map glyph

Hi,  
I am trying to display 50 gene level RNA-SEQ expression value (percentile) with subtrack and heat map glyph. I chose track space as compact, but one subtrack always show in two or three lines instead of one line. Any idea why? 
data is loaded to mysql db. The related config file look like this:
########
feature  = RNA-Seq
glyph    = heat_map
start_color = white
end_color   = black
min_score   = 0
max_score   = 100
category = RNA-Seq
bump = 1
key         = RNA-Seq Percentiled Gene Expression
subtrack select = Sample source
subtrack table  =  control 1;
                   control 2;
                   case1;
                   case2;
                   ......

Thanks,
Jeff 








------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
krkerwin | 14 Oct 06:47 2014
Picon
Picon

using ybrowse

Thomas:

 

I just sent Astrid an email regarding ybrowse when I found this email address at the bottom of the webpage.  I was able to download the Variant Frequency by Haplogroup and now need to get the info below to submit our CTS4466 SNPs to ISOGG

 

I need to use ybrowse to find the following for example.  I’ve used the previous database when my family took the WTY test but have since forgotten the details.

 

Name:

CTS11338

Type:

snp

Source:

point

Position:

ChrY:23075481..23075481 (+ strand)

Length:

1

ISOGG_haplogroup:

not listed

YCC_haplogroup:

Aprrox. hg: I

allele_anc:

C

allele_der:

T

comments:

Syn. with CTS10400

count_derived:

0

count_tested:

4

mutation:

C to T

primer_f:

CTS11338_F TGACAGGGGGATGCTTATTG

primer_r:

CTS11338_R GTGTTCCATCAGCCTGTGAG

ref:

Chris Tyler-Smith (2011)

primary_id:

81101

gbrowse_dbid:

chrY:database

 

Thank you very much in advance.  We have quite a few SNPs to submit thanks to you and Astrid.

 

Apparently ISOGG is starting almost from scratch for the R Haplogroup which I believe is likely based on updated technology and methodology used in the submission process.

 

Kathleen

 

 

------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Oliver Pelz | 17 Oct 09:34 2014

GBRowse CGI-Parameter "add" is not working on my installation

Hi again,

after I could fix my problems with the wrong session type on my centos machine (see mailing list email about topic "cannot set admin password") I run in the next trouble.

For me  GBrowes's "add" functionality is not working (http://gmod.org/wiki/GBrowse_Configuration/URL_schema)

1.If I access the following URL with or without user_accounts enabled, everything works fine:

http://localhost/cgi-bin/gb2/gbrowse_img/flybase/?name=wls;type=GENE+TXN;width=580;keystyle=between;grid=on


2.If I "add" some custom track information using the add-parameter e.g.:
http://localhost/cgi-bin/gb2/gbrowse_img/flybase/?name=wls;type=GENE+TXN;width=580;keystyle=between;grid=on;add=3L+E-RNAi+wls:1+11159720..11160708;add=3L+E-RNAi+wls:2+11160919..11161014;add=3L+E-RNAi+wls:3+11161237..11162741;style=E-RNAi+glyph=segments+fgcolor=black+bgcolor=plum;

I get an "Internal Server Error" in the browser. Looking at apache log file I see:

[Fri Oct 17 09:10:40 2014] [error] [client 192.108.26.43] Sessionid unavailable at /usr/local/lib64/perl5/Bio/Graphics/Browser2/UserDB.pm line 502.
[Fri Oct 17 09:10:40 2014] [error] [client 192.108.26.43] Premature end of script headers: gbrowse_img

There is another "Sessionid unavailable" - thread in the mailing list, but it was never resolved (http://generic-model-organism-system-database.450254.n5.nabble.com/Sessionid-unavailable-with-gbrowse-img-and-login-system-td5711879.html).
Also if i set gbrowse_img path to gbrowse I get the same error.
I suspect it has something to do with the user accounts but I cannot find anything.
I played around again with the following GBrowse.conf parameters:

session lock type
upload_db_adaptor
user_account_db
admin_account
admin_dbs

but nothing can cure my problem.

The flybase database is a mysql database I imported from gbrowse 1.7 and which I migrated the database conf file. As I can see all the data when not using the cgi parameter "add" I think this is not the issue.

My setup is:
* Using centos 6.5
* building perl v.5.18.1
* installed latest cpan, bioperl and gbrowse using cpan:
* as of 14/10/14: CPAN 2.05, BioPerl-1.6.923., GBrowse-2.55




Best,
Oliver

------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Nadine Elpida Tatto | 16 Oct 11:21 2014
Picon

2 Problems concerning track loading/Error Message

Hi there,

I've come to administrate a gbrowse2 which I didn't set up by myself and ran into some problems
now.http://www.pichiagenome.org/ is the site

1) Most of the time there is an error message popping up I can't figure out the reason for:
------------- EXCEPTION: Bio::Root::Exception ------------- MSG: getting the feature_ids failed
STACK: Error::throw STACK: Bio::Root::Root::throw
/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:472 STACK:
Bio::DB::Das::Chado::_by_alias_by_name
/usr/local/share/perl/5.10.1/Bio/DB/Das/Chado.pm:1527 STACK:
Bio::DB::Das::Chado::get_feature_by_name
/usr/local/share/perl/5.10.1/Bio/DB/Das/Chado.pm:1340 STACK:
Bio::Graphics::Browser2::Region::_feature_get
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Region.pm:344 STACK:
Bio::Graphics::Browser2::Region::lookup_features
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Region.pm:266 STACK:
Bio::Graphics::Browser2::Region::search_db
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Region.pm:205 STACK: Bio::Graphics::Browser2::Region::search_feature
 s /usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Region.pm:151 STACK:
Bio::Graphics::Browser2::RegionSearch::search_features_locally
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/RegionSearch.pm:412 STACK:
Bio::Graphics::Browser2::RegionSearch::search_features
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/RegionSearch.pm:301 STACK:
Bio::Graphics::Browser2::Render::region
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Render.pm:1137 STACK:
Bio::Graphics::Browser2::Render::segment
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Render.pm:1191 STACK:
Bio::Graphics::Browser2::Render::_update_state
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Render.pm:1898 STACK:
Bio::Graphics::Browser2::Render::update_state
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Render.pm:1888 STACK
 : Bio::Graphics::Browser2::Render::run
/usr/local/lib/perl/5.10.1/Bio/Graphics/Browser2/Render.pm:290 STACK:
/usr/lib/cgi-bin/gb2/gbrowse:50 

2) The tracks were loading without problems 2 or 3 weeks ago, but now without any reason they don't load anymore

This stuff occures with IE, Chrome and Firefox, so I assume it does not depend on the browser.

I would appreciate any hint for solving this problems

Thank you

Nadine

------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
Oliver Pelz | 15 Oct 17:11 2014

cannot set admin password

Hi!

I am just installed GBrowse and run into trouble:

* Using centos 6.5
* building perl v.5.18.1
* installed latest cpan, bioperl and gbrowse using cpan:
* as of 14/10/14: CPAN 2.05, BioPerl-1.6.923., GBrowse-2.55

right after installation first thing I did without touching anything (not GBrowse.conf etc. ):

sudo -uapache ./gbrowse_set_admin_passwd.pl

gives me:

Use of uninitialized value in warn at /usr/local/lib64/perl5/Bio/Graphics/Browser2/Session.pm line 153, <STDIN> line 2.
[20194] session lock timed out on request after 50.000s
: http://localhost  at /usr/local/lib64/perl5/Bio/Graphics/Browser2/Session.pm line 153, <STDIN> line 2.
No SMTP server found in globals at /usr/local/lib64/perl5/Bio/Graphics/Browser2/SendMail.pm line 29, <STDIN> line 2.
No SMTP server found in globals at /usr/local/lib64/perl5/Bio/Graphics/Browser2/SendMail.pm line 29, <STDIN> line 2.
Mail Error

Am I missing something?
If I manually increase the lock time in Session.pm I get the same result.

Best,
Oliver Pelz
------------------------------------------------------------------------------
Comprehensive Server Monitoring with Site24x7.
Monitor 10 servers for $9/Month.
Get alerted through email, SMS, voice calls or mobile push notifications.
Take corrective actions from your mobile device.
http://p.sf.net/sfu/Zoho
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Gmane