Nalini Kanta Choudhury | 26 Aug 12:54 2015
Picon

Problem in installation

Dear sir,
            I installed Gbrowse in my laptop but it is not showing the genome track for visualisation. Please kindly help me in this regards.







Thanks & Regard
  NaliniKanta Choudhury
  IASRI,Library Avenue,
  New Delhi-1100120
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Scott Cain | 24 Aug 17:20 2015
Picon

Re: Regarding the problem in GBrowse Installation

Hi Nalini,

I cc'ed the GBrowse mailing list.  Can you please look at the apache error log for any messages that might relate to this problem?

Scott


On Mon, Aug 24, 2015 at 11:11 AM, Nalini Kanta Choudhury <nalini.ctc.7-Re5JQEeQqe8AvxtiuMwx3w@public.gmane.org> wrote:


Respected Sir,
                     I have installed GBrowse in my laptop under Linux environment (Fedora 20). But it shows some error on launching dummy example (Yeast). I cannot trace it. Please kindly help me in this regard. I have attached a file which showed the error like this.  







Thanks & Regard
  NaliniKanta Choudhury
  IASRI,Library Avenue,
  New Delhi-1100120





--
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Zhou Albert | 21 Aug 15:30 2015
Picon

"Got a sequence without letters" error

Hi everyone,

I'm using GBrowse 2.54 with PostgreSQL backend on a server running Ubuntu 14.04 LTS. I have imported GFF and FASTA data into a database using bp_seqfeature_load, and then connected to GBrowse with Bio::DB::SeqFeature::Store adaptor.

The features (mRNA, CDS, exons etc.) are displayed correctly. However when I try to show the DNA sequences, the track remains empty, and I find several messages in the apache error log similar as:

MSG: Got a sequence without letters. Could not guess alphabet, referer: http://127.0.0.1/cgi-bin/gbrowse/gbrowse/testdb/?name=scaffold_1%3A2016111..2016123

I’m pretty sure the FASTA files have been loaded into the database (I can see the "sequence text" values in the “sequence” table and they are not empty). The FASTA files look like:

>hxAUG26up1s1g18t1 loc=scaffold_1:173236-177401:+;type=CDS.dpx26mx19;nx=10;len=3585
ATGGAAGAACCCAAGGAAAGTCCCGAGAGTGTAATTGCATCCGTTGTGAA
TGAAAATGAGACCCCGCGAGTCTTGCCCAACTTTCAAATCAATCGTGATA
...

and  the GFF file includes entries like:

scaffold_1      dpx26mx19       mRNA    173130  190600  816,1521/1899,3.612,3502,14,3585,0      +       .       ID=hxAUG26up1s1g18t1;(and some more attributes here)
...

It seems to me that the GBrowse should be able to link them together, and show the sequences correctly. Could someone tell me where the problem is? 

Many thanks!

Albert


------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Tanuja Harshani Peiris | 6 Aug 19:50 2015
Picon

Retrieving sequences

Hi Eric,
Thank you for the note on the mk4 sequence fix. I still have issues since the mk4 numbers that I have is not retrieving anything.
For example, mk4.001927.02.01 or mk4.00165.01 does not retrieve any sequences with the asexual, sexuals or the unigenes. 
I need to 
1. Make sure the mk4 numbers match with the sequence and confirm.
2. Find the correct new method of labeling sequences you have.
Can you help me with this please?
Thank you
Harshani



--
T. Harshani Peiris, PhD
Buck Institute for Research in Aging
Novato, CA                    
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
v singh | 28 Jul 23:35 2015
Picon

Fwd: SNPs by accession track

Dear All,

I want to upload a track with 250+ subtracks for displaying SNPs in samples , called  ‘SNPs by accession’ track. I generated a gff for the same looking like this —


### gff-version 3 

### source VCF file -->Example.vcf 

Ca1 Example.vcf SNP 32031 32031 . + . acgt=0 0 1 0;ref=C; line=Karab_062A;Name=cicar.line.kphxhfd

Ca1 Example.vcf SNP 32031 32031 . + . acgt=0 0 1 0;ref=C; line=Karab_062A_x_96029_02;Name=cicar.line.eq315e0

Ca1 Example.vcf SNP 32031 32031 . + . acgt=0 0 1 0;ref=C; line=Karab_062A_x_96029_03;Name=cicar.line.my4unk7

Ca1 Example.vcf SNP 32031 32031 . + . acgt=0 0 1 0;ref=C; line=Karab_062A_x_96029_16;Name=cicar.line.5wtysew

Ca1 Example.vcf SNP 32031 32031 . + . acgt=0 0 1 0;ref=C; line=Karab_062A_x_96029_23;Name=cicar.line.1jsnidx

Ca1 Example.vcf SNP 32031 32031 . + . acgt=0 0 2 0;ref=C; line=S2Drd_107B;Name=cicar.line.6ley7td


Here’s what I used in the config file —


[SNPbyAcc]

database     = snplines

feature      = SNP

glyph        = triangle

point        = 1

orient       = N

height       = 5

label        = 1

bgcolor      = blue

subtrack select   = Line tag_value line ;

subtrack table   =  96029;

  Bari1_092;

  Bari1_092_x_96029_01;

  Bari1_092_x_96029_02;

  Bari1_092_x_96029_03;

  Bari1_092_x_96029_05;

  Bari1_092_x_96029_07;

  Bari1_092_x_96029_08;

  Bari1_092_x_96029_09;

 

This track loads alright without the subtrack select option. once I choose the subtrack select option… essentially no data is displayed .. please see attached pdf . It will be a great help, if you can help diagnose what I’m doing wrong here. 

Many Thanks,

Vasantika
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Sofia Robb | 14 Jul 18:11 2015

searching a second DB

Hi Everyone,

I have a gbrowse 2 set up that uses two databases. The first database is in the [General] section and the 2nd is in a separate [database] stanza. I have "search options = default +autocomplete" in my 2nd Database stanza and the autocomplete is working but if I search for one of the names that pops up in the autocomplete I get 
The search timed out; try a more specific search 

Is there something else I need to add to my 2nd db stanza so that the search function works?

Thanks,
Sofia

------------------------------------------------------------------------------
Don't Limit Your Business. Reach for the Cloud.
GigeNET's Cloud Solutions provide you with the tools and support that
you need to offload your IT needs and focus on growing your business.
Configured For All Businesses. Start Your Cloud Today.
https://www.gigenetcloud.com/
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Ramesh krishnan Ramasamy | 12 Jul 06:06 2015
Picon

500 internal server error

Hello everyone,

Today, I have installed GBrowse2 in my Ubuntu server 14.04.2. I used automatic installation and followed defaults in directory selection. None of the given example links are working, which returns 500 internal server error.

Error.log shows following error:

[Sun Jul 12 03:53:50.734165 2015] [cgi:error] [pid 1320] [client xx.xxx.xxx.xx:52657] AH01215:  at /usr/local/lib/perl/5.18.2/Bio/Graphics/Browser2/UserTracks/Database.pm line 22., referer: http://xx.x.xxx.xxx/gbrowse2/
[Sun Jul 12 03:53:50.738689 2015] [cgi:error] [pid 1320] [client xx.xxx.xxx.xx:52657] End of script output before headers: gbrowse, referer: http://xx.x.xxx.xxx/gbrowse2/

I appreciate any sort of help.

Thanks
Ramesh
------------------------------------------------------------------------------
Don't Limit Your Business. Reach for the Cloud.
GigeNET's Cloud Solutions provide you with the tools and support that
you need to offload your IT needs and focus on growing your business.
Configured For All Businesses. Start Your Cloud Today.
https://www.gigenetcloud.com/
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Aimin Li | 7 Jul 04:20 2015

80 millions SNPs, track rendering error, timeout, try viewing a smaller region

Hi, everyone,
I loaded about 80 millions SNPs into GBrowse 2.55. I can view a SNP or a small region (100bp) on gbrowse.
However, it failed when viewing about 500bp or 1kbp region. The following is what I tested and configuration.

#======================
# TEST :
WEBSITE:
http://res.xaut.edu.cn/cgi-bin/gb2_dspsp/gbrowse/dspsp/

error,failed:
1:13,026,145..13,026,244
http://res.xaut.edu.cn/cgi-bin/gb2_dspsp/gbrowse/dspsp/?name=NUGGC

success:
1:82,234..82,534
http://res.xaut.edu.cn/cgi-bin/gb2_dspsp/gbrowse/dspsp/?name=SSCrs01000011459

#======================
# gff3: ( about 80,000,000 rows/features)
1    dspsp_general    SNP    12867    12867    .    +    .    ID=SSCrs01000012867;Name=SSCrs01000012867;Ref=T;Alt=G;dbSNPid=.
1    dspsp_general    SNP    12894    12894    .    +    .    ID=SSCrs01000012894;Name=SSCrs01000012894;Ref=A;Alt=C;dbSNPid=.
1    dspsp_general    SNP    26956    26956    .    +    .    ID=SSCrs01000026956;Name=SSCrs01000026956;Ref=C;Alt=G;dbSNPid=.
1    dspsp_general    SNP    42241    42241    .    +    .    ID=SSCrs01000042241;Name=SSCrs01000042241;Ref=T;Alt=G;dbSNPid=.
1    dspsp_general    SNP    53053    53053    .    +    .    ID=SSCrs01000053053;Name=SSCrs01000053053;Ref=T;Alt=A;dbSNPid=.
1    dspsp_general    SNP    72646    72646    .    +    .    ID=SSCrs01000072646;Name=SSCrs01000072646;Ref=A;Alt=G;dbSNPid=.
1    dspsp_general    SNP    76467    76467    .    +    .    ID=SSCrs01000076467;Name=SSCrs01000076467;Ref=T;Alt=A;dbSNPid=rs340612171
1    dspsp_general    SNP    76469    76469    .    +    .    ID=SSCrs01000076469;Name=SSCrs01000076469;Ref=A;Alt=C;dbSNPid=rs322594773

#======================
# config:
[dspsp_outgroup]
feature       = SNP:dspsp_outgroup
glyph         = triangle
point         = 1
orient        = N
height        = 6
bgcolor       = blue
fgcolor       = blue
key           = SNPs (outgroup)
category      = SNP

[dspsp_general]
feature       = SNP:dspsp_general
glyph         = triangle
point         = 1
orient        = N
height        = 6
bgcolor       = blue
fgcolor       = blue
key           = SNPs (general)
category      = SNP

#======================
# gbrowse.config:
slave_timeout          =200  
global_timeout         =300 
search_timeout         =200  

Thanks a lot!

Best wishes,
Mr Aimin Li
School of Computer Science and Technology,
Xidian University, Xi'an, China



------------------------------------------------------------------------------
Don't Limit Your Business. Reach for the Cloud.
GigeNET's Cloud Solutions provide you with the tools and support that
you need to offload your IT needs and focus on growing your business.
Configured For All Businesses. Start Your Cloud Today.
https://www.gigenetcloud.com/
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Hong Wang | 2 Jul 16:27 2015
Picon

tutorial on the website

Hi,

 

I am a scientist at Eli Lilly. I am interested in using the website. Do you offer tutorials?

 

Thanks!

 

Hong

 

Hong Wang, Ph.D.

Sr. Research Scientist

Tailored Therapeutics Neuroscience

Eli Lilly and Company

Lilly Corporate Center, Indianapolis, IN 46285, U.S.A.

317-433-2879 (office)

Wang_hong2-hG+hP7PK2UgAvxtiuMwx3w@public.gmane.org |www. Lilly.com

 

CONFIDENTIALITY NOTICE: This email message (including all attachments) is for the sole use of the intended recipient(s) and may contain confidential information. Any unauthorized review, use, disclosure, copying or distribution is strictly prohibited. If you are not the intended recipient, please contact the sender by reply email and destroy all copies of the original message

 

------------------------------------------------------------------------------
Don't Limit Your Business. Reach for the Cloud.
GigeNET's Cloud Solutions provide you with the tools and support that
you need to offload your IT needs and focus on growing your business.
Configured For All Businesses. Start Your Cloud Today.
https://www.gigenetcloud.com/
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Wiese, Matthew B. | 25 Jun 07:29 2015
Picon

Set up GBrowse to compare the genes of n number of isolates

GBrowse Team,


I'm setting up a GBrowse system for my lab's particular data on fungi.


The researchers would like to use GBrowse to compare the gene differences between two or more isolates.


I've looked through the wiki and have tried web searches but nothing has come up.


Is it possible to modify GBrowse to view multiple genomes and compare their differences in genes?



Thanks,

Matt Wiese

------------------------------------------------------------------------------
Monitor 25 network devices or servers for free with OpManager!
OpManager is web-based network management software that monitors 
network devices and physical & virtual servers, alerts via email & sms 
for fault. Monitor 25 devices for free with no restriction. Download now
http://ad.doubleclick.net/ddm/clk/292181274;119417398;o
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Umair Seemab | 24 Jun 11:12 2015
Picon
Picon

multiple scaffold download

Hi,

My name is Umair and I was trying to download scaffold sequence of  
Pogona  
(https://genomics.canberra.edu.au/gbrowse/gbrowse/pogona_pvi1.1/). It  
is possible to download one scaffold sequence but I need to know is  
there any way to download multiple scaffolds at once. I shall wait for  
your reply. Thanks.

Best,
Umair

------------------------------------------------------------------------------
Monitor 25 network devices or servers for free with OpManager!
OpManager is web-based network management software that monitors 
network devices and physical & virtual servers, alerts via email & sms 
for fault. Monitor 25 devices for free with no restriction. Download now
http://ad.doubleclick.net/ddm/clk/292181274;119417398;o

Gmane