Sam Hokin | 5 Feb 00:33 2016

Illegible formatting of bases on zoomed-in segments glyph

Hi, I hope I can attach to an email to the list, because without it this is pretty hard to envision. I'm running
a stock GBrowse2 on 
a Google Cloud Debian machine - works great for the most part, all the stuff needed came down from the repo.
The one issue I'm 
running into is that I can't make out the bases of reads when I zoom in. They're made with this section in the
config, 
feature=match, glyph=segments. The glyph works fine when zoomed out, but when zoomed in it shows a lot of
overlapping tiny-font text 
for the bases along with solid color from the overlapping reads.

Any suggestions?

[FC1154_May2014.PollenCL.reads]
feature        = match
category       = Fowler Silk_Pollen_RawRNAseqData:FC1154_May2014
citation       = Fowler Lab, Oregon State, FC1154_May2014 read set. PollenCL: B73 pollen only (techrep2)
database       = FC1154_May2014.PollenCL
key            = PollenCL READS: B73 pollen only (techrep2)
bgcolor        = orange
fgcolor        = orange
glyph          = segments
draw_target    = 1
show_mismatch  = 1
mismatch_color = red
bump           = fast
------------------------------------------------------------------------------
Site24x7 APM Insight: Get Deep Visibility into Application Performance
(Continue reading)

Vanessa Oliveira | 21 Jan 20:12 2016
Picon

login account to MSeqDR

Hello,

I would like to subscribe to MSeqDR but I am having problems to visualize the web page for that. Please, could you please give me assistance to get my access to this consortium?

Many thanks in advance!

Cheers,

Vanessa  
------------------------------------------------------------------------------
Site24x7 APM Insight: Get Deep Visibility into Application Performance
APM + Mobile APM + RUM: Monitor 3 App instances at just $35/Month
Monitor end-to-end web transactions and take corrective actions now
Troubleshoot faster and improve end-user experience. Signup Now!
http://pubads.g.doubleclick.net/gampad/clk?id=267308311&iu=/4140
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
arunasalam.naguleswaran | 13 Jan 09:54 2016
Picon
Picon

FastaDumper

Dear Sir or Madam,

I am using Gbrowse 2.55 locally in our server and it has problems to dump the Fasta sequence. Please see the attached image. Everything else is working fine. Please let me know whether I have to modify something to get it working.

Thank you,

Yours sincerely,
Naguleswaran
------------------------------------------------------------------------------
Site24x7 APM Insight: Get Deep Visibility into Application Performance
APM + Mobile APM + RUM: Monitor 3 App instances at just $35/Month
Monitor end-to-end web transactions and take corrective actions now
Troubleshoot faster and improve end-user experience. Signup Now!
http://pubads.g.doubleclick.net/gampad/clk?id=267308311&iu=/4140
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Jessica Wilson | 9 Jan 20:07 2016

Metazome Website

body {height:100%;width:100%;margin-top: 0px !important; margin-bottom: 0px !important; padding:0px !important; mso-margin-top-alt:0px !important; mso-margin-bottom-alt:0px !important; mso-padding-alt: 0px 0px 0px 0px !important;} <at> media only screen and (max-width : 480px) { .full_width{ width: 100% !important; } }
View in your browser

 

To Whom It May Concern,

Recently I went to the Metazome website. Sunpoint is in the business of assisting companies like yours build a powerful Internet presence by constructing websites and crafting marketing strategies. By taking several key steps we can help you create revenues through strong messaging and additional traffic.

When I visited your website I was able to experience what others do when they visit. Some of what I read and saw was great, but other things also caught my eye for the wrong reasons.

I would like to speak to you about your site for five minutes. During the telephone meeting I will offer a few suggestions that I am sure you will find helpful.

After looking over the site and analyzing all the strengths and weaknesses I feel you could be building more business if you make some simple changes.

For example your current website design is in many ways old-fashioned in its presentation. By adding more promotional writing and a newer layout you could re-engage your current customers who know you while attracting new website visitors. Also, by removing some biographical and informational text and using more marketing driven content you cause people to WANT to visit, call, or contact you.

With the implementation of new internet technologies, creating and owning a cutting edge website that works is both simple and affordable. Doing this would require little time or work on your behalf and your site could be completed in a short period of time.

I would appreciate an opportunity to help you with all of this.

Is there a good time when we can schedule a phone meeting and go over some ideas I have to help you?

If you are interested simply respond to this email or email me at jwilson-5MPjC1S6ncxCpjqP0VxSwUEOCMrvLtNR@public.gmane.org.

You can also visit our website and portfolio at www.sunpointdesigns.com/portfolio

Thank You,
Jessica Wilson
Sunpoint Web Design
www.sunpointdesigns.com
jwilson-5MPjC1S6ncxCpjqP0VxSwUEOCMrvLtNR@public.gmane.org         

 

   
     
  This email was sent to gmod-gbrowse-5NWGOfrQmneRv+LV9MX5uipxlwaOVQ5f@public.gmane.org by jwilson-5MPjC1S6ncxCpjqP0VxSwUEOCMrvLtNR@public.gmane.org  
  PO Box 5027, Peoria, 85385, United States  
  If you feel you have received this message in error or you did not authorize the use of your email address please Click here to report.  
   
 
   
 
#outlook a{padding: 0;}.ReadMsgBody{width: 100%;}.ExternalClass{width: 100%;}body{margin: 0;padding: 0;}img{border: 0;line-height: 100%; outline: none;text-decoration: none;}table, td{mso-table-lspace: 0pt;mso-table-rspace: 0pt;} table, td.addressBookCopy{padding: 0;} #bodyTable, #bodyCell{height: 100% !important;margin: 0;padding: 0;width: 100% !important;}#bodyCell{padding-top: 0;padding-right: 20px;padding-bottom: 20px;padding-left: 20px;}#templateContainer{width: 100%;}/* <at> tab Page <at> section background color <at> tip Set the background color for your email. You may want to choose a color that matches your company's branding. <at> theme page*/body, #bodyTable{/* <at> editable*/background-color: #ffffff;}table#footerLinks{font-size: 14px;width: 100%;text-align: center;}table#footerLinks td, a.footerClick{color: #333333;}table#footerLinks td{padding-top: 10px;color: #333333;padding-bottom: 10px;} <at> media only screen and (max-width: 480px){body, table, td, p, a, li, blockquote{-webkit-text-size-adjust: none !important;} body{width: auto !important;} td[id=bodyCell]{padding: 10px;} /* <at> tab Mobile Styles <at> section template width <at> tip Make the template fluid for portrait or landscape view adaptability. If a fluid layout doesn't work, set width to 300px instead.*/ table[id=templateContainer]{/* <at> tab Mobile Styles <at> section template width <at> tip Make the template fluid for portrait or landscape view adaptability. If a fluid layout doesn't work, set width to 300px instead.*/max-width: 600px !important; /* <at> editable*/width: 100% !important;} /* <at> tab Mobile Styles <at> section heading 1 <at> tip Make the first-level headings larger in size for better readability on small screens.*/ h1{/* <at> editable*/font-size: 36px !important; /* <at> editable*/line-height: 100% !important;} /* <at> tab Mobile Styles <at> section heading 2 <at> tip Make the second-level headings larger in size for better readability on small screens.*/ h2{/* <at> editable*/font-size: 20px !important; /* <at> editable*/line-height: 100% !important;} /* <at> tab Mobile Styles <at> section heading 3 <at> tip Make the third-level headings larger in size for better readability on small screens.*/ h3{/* <at> editable*/font-size: 18px !important; /* <at> editable*/line-height: 100% !important;} /* <at> tab Mobile Styles <at> section heading 4 <at> tip Make the fourth-level headings larger in size for better readability on small screens.*/ h4{/* <at> editable*/font-size: 14px !important; /* <at> editable*/line-height: 100% !important;} table[id=templatePreheader]{display: none !important;} font[id=removeMain]{display: none !important;text-decoration: none;} table[id=templateHeader]{width: 100% !important;padding: 5px;} /* <at> tab Mobile Styles <at> section header text <at> tip Make the header content text larger in size for better readability on small screens.*/ td[class=headerContent]{/* <at> editable*/font-size: 18px !important; /* <at> editable*/line-height: 125% !important;} /* <at> tab Mobile Styles <at> section body text <at> tip Make the body content text larger in size for better readability on small screens.*/ td[class=bodyContent]{/* <at> editable*/font-size: 18px !important; /* <at> editable*/line-height: 125% !important;} /* <at> tab Mobile Styles <at> section footer text <at> tip Make the footer content text larger in size for better readability on small screens.*/ td[class=c]{/* <at> editable*/font-size: 14px !important; /* <at> editable*/line-height: 150% !important;} td[class=footerContent] a{display: inline-block !important; }} span.yshortcuts {color:#000} span.yshortcuts:hover, span.yshortcuts:active, span.yshortcuts:focus {text-decoration:none; color:#000; background-color:none; border:none} *[role|="main"]{padding:0px !important;width:100% !important;margin:0px !important;}.msg-body inner{width:100% !important; padding:0px !important;margin:0px !important; left:0px !important;}.msg-body {width:100% !important; padding:0px !important;margin:0px !important; left:0px; !important}.inner{width:100% !important; padding:0px !important ;margin:0px !important; left:0px !important; }
------------------------------------------------------------------------------
Site24x7 APM Insight: Get Deep Visibility into Application Performance
APM + Mobile APM + RUM: Monitor 3 App instances at just $35/Month
Monitor end-to-end web transactions and take corrective actions now
Troubleshoot faster and improve end-user experience. Signup Now!
http://pubads.g.doubleclick.net/gampad/clk?id=267308311&iu=/4140
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Emilio A. Alvarado Ortiz | 16 Dec 21:56 2015

Re: Internal Server Error

Hello,

 

Hope all is well. I was modifying the ‘gerjam.conf’ to add and change some tracks but the link broke. It was working fine before I started adding/deleting tracks. I checked the server error log and it says the following:

 

[Wed Dec 16 15:49:08 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: STACK: /usr/lib/cgi-bin/gb2/gbrowse:35

[Wed Dec 16 15:49:08 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: -----------------------------------------------------------

[Wed Dec 16 15:49:08 2015] [error] [client 127.0.0.1] Premature end of script headers: gbrowse

[Wed Dec 16 15:49:16 2015] [warn] mod_fcgid: cleanup zombie process 7822

 

 

When I try to access the Gerbera jamesonii browser I get an “Internal Server Error” message. I have attached the GBrowse and gerjam configuration file. Do you know a workaround this error? I would really appreciate your help.

 

 

Thank you,

 

-Emilio

 

From: Scott Cain [mailto:scott <at> scottcain.net]
Sent: Thursday, October 29, 2015 3:47 PM
To: Emilio A. Alvarado Ortiz
Cc: Timothy Parnell; Gbrowse (E-mail)
Subject: Re: [Gmod-gbrowse] Blank Page Error

 

Hi Emilio,

 

If you look in the GBrowse.conf file for the line that starts

 

 smtp_gateway         = localhost

 

you will notice that there is a blank space before the smtp part.  Remove that space.  Having the space there is telling it to add it on to the item before it (which reads "public_files = 10"), which is why the error message is complaining that "10 smtp_gateway..." isn't a number).

 

Scott

 

 

On Thu, Oct 29, 2015 at 4:27 PM, Emilio A. Alvarado Ortiz <eaalvarado <at> cpp.edu> wrote:

Hi Scott,

I have attached the configure files that I was working on. Thank you for your help.


Regards,

-Emilio

-----Original Message-----
From: Domain Admin [mailto:scott <at> scottcain.net]
Sent: Thursday, October 29, 2015 5:13 AM
To: Emilio A. Alvarado Ortiz

Cc: Timothy Parnell; Gbrowse (E-mail)
Subject: Re: [Gmod-gbrowse] Blank Page Error

Hi Emilio,

I suspect you have a stray space at the beginning of a line in your configure file. Look in the file around where the smtp line is. The reason this is likely the problem is that spaces at the beginning of a line in the config indicate a continuation, so that it's concatenated to the line before it. If that doesn't make sense, or you can't find the problem, you can attach your config to your response and we can take a look.

Scott


Sent from my iPhone

> On Oct 28, 2015, at 7:27 PM, Emilio A. Alvarado Ortiz <eaalvarado <at> cpp.edu> wrote:
>
> Hi Timothy,
>
> Thank you for your help on uploading the GFF and Fasta files into GBrowse. I was able to successfully upload and view everything. However, today I have been having an issue in which accessing the yeast or any other database result in a blank page. It only happens when I search for a specific database "http://localhost/fgb2/gbrowse/yeast_advanced/". I have attached a screenshot of the blank page I receive.
>
> After reading the tutorial, I checked the /var/log/apache2/error.log file and it contains the following error log:
>
> [Wed Oct 28 19:00:25 2015] [warn] [client 127.0.0.1] mod_fcgid:
> stderr: DBD::SQLite::db selectcol_ [Wed Oct 28 19:00:25 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: arrayref failed: near "smtp_gateway": syntax error at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/UserTracks/Database.pm line 192.
> [Wed Oct 28 19:00:25 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Can't use an undefined value as an ARRAY reference at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/UserTracks/Database.pm line 193.
> [Wed Oct 28 19:18:39 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Argument "10 smtp_gateway         = localhost" isn't numeric in numeric lt (<) at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/Render/HTML.pm line 1186., referer: http://localhost/
> [Wed Oct 28 19:18:39 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Argument "10 smtp_gateway         = localhost" isn't numeric in numeric lt (<) at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/Render/HTML.pm line 1193., referer: http://localhost/
> [Wed Oct 28 19:18:39 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Argument "10 smtp_gateway         = localhost" isn't numeric in subtraction (-) at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/Render/HTML.pm line 1194., referer: http://localhost/
> [Wed Oct 28 19:18:39 2015] [warn] [client 127.0.0.1] mod_fcgid:
> stderr: DBD::SQLite::db selectcol_, referer: http://localhost/ [Wed
> Oct 28 19:18:39 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: arrayref failed: near "smtp_gateway": syntax error at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/UserTracks/Database.pm line 192., referer: http://localhost/ [Wed Oct 28 19:18:39 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Can't use an undefined value as an ARRAY reference at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/UserTracks/Database.pm line 193., referer: http://localhost/
> [Wed Oct 28 19:18:43 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Argument "10 smtp_gateway         = localhost" isn't numeric in numeric lt (<) at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/Render/HTML.pm line 1186., referer: http://localhost/
> [Wed Oct 28 19:18:43 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Argument "10 smtp_gateway         = localhost" isn't numeric in numeric lt (<) at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/Render/HTML.pm line 1193., referer: http://localhost/
> [Wed Oct 28 19:18:43 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr: Argument "10 smtp_gateway         = localhost" isn't numeric in subtraction (-) at /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/Render/HTML.pm line 1194., referer: http://localhost/
> [Wed Oct 28 19:18:43 2015] [warn] [client 127.0.0.1] mod_fcgid:
> stderr: DBD::SQLite::db selectcol_, referer: http://localhost/ [Wed
> Oct 28 19:18:43 2015] [warn] [client 127.0.0.1] mod_fcgid: stderr:
> arrayref failed: near "smtp_gateway": syntax error at
> /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/UserTracks/Database
> .pm line 192., referer: http://localhost/ [Wed Oct 28 19:18:43 2015]
> [warn] [client 127.0.0.1] mod_fcgid: stderr: Can't use an undefined
> value as an ARRAY reference at
> /opt/gbrowse/lib/perl/5.14.2/Bio/Graphics/Browser2/UserTracks/Database
> .pm line 193., referer: http://localhost/
>
>
> I believe I am getting a blank page because of the "smtp_gateway" sytax error. Do you know a workaround this problem?
>
> Once again, thank you for your help.
>
>
> Regards,
>
> -Emilio
>
> -----Original Message-----
> From: Timothy Parnell [mailto:Timothy.Parnell <at> hci.utah.edu]
> Sent: Wednesday, October 21, 2015 9:43 PM
> To: Emilio A. Alvarado Ortiz
> Cc: Gbrowse (E-mail)
> Subject: Re: [Gmod-gbrowse] Gbrowse bp_seqfeature_load WARNING Error
>
> Hi Emilio,
> You should be able to look back at archived messages on this mailing list to find some advice; this comes up a lot. The most likely culprit is that you don’t have the chromosomes (or scaffold or reference sequence) entered in your GFF3 file. Something like
> chr1    UCSC    chromosome      1       249250621       .       .       .       Name=chr1;ID=chr1
>
> Tim
>
>> On Oct 20, 2015, at 6:55 PM, Emilio A. Alvarado Ortiz <eaalvarado <at> cpp.edu> wrote:
>>
>> Hi Timothy,
>>
>> I was finally able to upload the fasta and GFF3 file using bp_seqfeature_load. I am using the GBrowse 2.52, VirtualBox Edition (32bit)  downloaded from http://gmod.org/wiki/GBrowse2_VMs. I believe the problem was the because I was running out of the /boot disk space. I increased the space by adding a new hard drive to the VM and the files successfully uploaded (see attached log).  However, now I have another issue, when I try to visualize what I just uploaded, I get a " Not Found" error. I have attached a screenshot of the error message. Do you know why it is not able to find it? I really appreciate your help.
>>
>>
>> Thank you,
>>
>> -Emilio
>>
>> -----Original Message-----
>> From: Timothy Parnell [mailto:Timothy.Parnell <at> hci.utah.edu]
>> Sent: Tuesday, October 20, 2015 12:21 PM
>> To: Emilio A. Alvarado Ortiz
>> Cc: Gbrowse (E-mail)
>> Subject: Re: [Gmod-gbrowse] Gbrowse bp_seqfeature_load WARNING Error
>>
>> Wow, that appears to be a really low level error that is below that of the BioPerl database adaptor. Are you running out of disk space or allocation issues where the mysql files are kept? You should solve any issues with the mysql server before dealing with the perl side of things.
>>
>> Also, make sure you use -c or create option in bp_seqfeature_load when re-loading a database; this will empty the existing tables before loading. I could imagine you might hit table limits if you keep loading and loading and loading on top of each other. I suppose it’s also possible your GFF3 is so large that you’re just running into the predefined limits of the SeqFeature store tables; these could be changed in the perl code if need be.
>>
>> I don’t know if this will help, but you may also want to consider increasing the parameters for the mysql server; I use the settings for a “large” system in /etc/my.cnf on my system. That’s mostly just caches and buffer sizes, though.
>>
>>
>> On Oct 20, 2015, at 12:10 PM, Emilio A. Alvarado Ortiz <eaalvarado <at> cpp.edu<mailto:eaalvarado <at> cpp.edu>> wrote:
>>
>> Hi Timothy,
>>
>> Thank you for the quick reply. When I turn off fast loading in the bp_seqfeature_load.pl load program, everything starts loading fine and then I get the same warning along with "The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358. Do you know what is triggering this error? I have attached the log file.
>>
>> --------------------- WARNING ---------------------
>> MSG: ID=666531 has been used more than once, but it cannot be found in the database.
>> This can happen if you have specified fast loading, but features sharing the same ID are not contiguous in the GFF file. This will be loaded as a separate feature.
>> Line 385661: "Lsat_1_v4_lg_1 protein2genome match_part 120131127
>> 120131795 486 - .
>> Name=gi%7C225435580%7Cref%7CXP_002283196.1%7C;ID=666531;Target=gi%7C2
>> 2
>> 5435580%7Cref%7CXP_002283196.1%7C%20200%20427;Gap=M68%20I1%20M11%20I4
>> %
>> 20M27%20I1%20M40%20D1%20M76;Scaffold=Lsat_1_v4_g_1_1079
>> "
>>
>> STACK Bio::DB::SeqFeature::Store::GFF3Loader::handle_feature
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:592
>> STACK Bio::DB::SeqFeature::Store::GFF3Loader::load_line
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:415
>> STACK Bio::DB::SeqFeature::Store::Loader::do_load
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/Loader.pm:433
>> STACK Bio::DB::SeqFeature::Store::Loader::load_fh
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/Loader.pm:353
>> STACK Bio::DB::SeqFeature::Store::Loader::load
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/Loader.pm:243
>> STACK toplevel /opt/gbrowse/bin/bp_seqfeature_load.pl:252
>> ---------------------------------------------------
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385661.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385661.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385662.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385662.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385663.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385663.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385664.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385664.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385665.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385665.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385666.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385666.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385667.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385667.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385668.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385668.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385669.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385669.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385670.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385670.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385671.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385671.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385672.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385672.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385673.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385673.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385674.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385674.
>> DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385675.
>> Transaction aborted because DBD::mysql::st execute failed: The table 'feature' is full at /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 1358, <GEN1> line 385675.
>>
>>
>> Thank you,
>>
>> -Emilio
>>
>> -----Original Message-----
>> From: Timothy Parnell [mailto:Timothy.Parnell <at> hci.utah.edu]
>> Sent: Tuesday, October 20, 2015 10:18 AM
>> To: Emilio A. Alvarado Ortiz
>> Cc:
>> gmod-gbrowse <at> lists.sourceforge.net<mailto:gmod-gbrowse <at> lists.sourcefor
>> ge.net>
>> Subject: Re: [Gmod-gbrowse] Gbrowse bp_seqfeature_load WARNING Error
>>
>> Hi Emilio,
>> As the error explains, your GFF3 file is re-using ID numbers. Normally, these should be unique within the file, and are used to help establish parent-child relationships. When loading, parents ideally should come before children in the GFF3 file so that they can be properly associated. When a child comes before the parent, I think it makes a dummy parent with that ID, and then throws this error when it finally comes across the parent later in the file.
>>
>> You can try turning off fast loading in the bp_seqfeature_load.pl load program, in which case out-of-order parents and children should be handled smartly. Just be prepared to let it run much, much longer (mysql isn’t so bad, sqlite is horrible with really big files).
>>
>> Sometimes, sorting the GFF3 by genomic coordinates might also help.
>>
>> Good luck,
>> Tim
>>
>> On Oct 19, 2015, at 5:23 PM, Emilio A. Alvarado Ortiz <eaalvarado <at> cpp.edu<mailto:eaalvarado <at> cpp.edu><mailto:eaalvarado <at> cpp.edu>> wrote:
>>
>> Hello,
>>
>> I am following the GBrowse NGS Tutorial from http://gmod.org/wiki/GBrowse_NGS_Tutorial#Start but I am getting the following error when running bp_seqfeature_load.pl. I can send you the fasta and gff3 file that I am trying to upload into GBrowse. Do you know a workaround this issue? I would really appreciate your help.
>>
>>
>> loading Lsat_1_v4_lg_1_1..252823024.gff3...
>>
>> --------------------- WARNING ---------------------
>> MSG: ID=3667958 has been used more than once, but it cannot be found in the database.
>> This can happen if you have specified fast loading, but features sharing the same ID are not contiguous in the GFF file. This will be loaded as a separate feature.
>> Line 31: "Lsat_1_v4_lg_1              GeneWise_St    CDS        12608    12931    .               .               0            ID=3667958;Scaffold=Lsat_1_v4_g_1_3464
>> "
>>
>> STACK Bio::DB::SeqFeature::Store::GFF3Loader::handle_feature
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:592
>> STACK Bio::DB::SeqFeature::Store::GFF3Loader::load_line
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/GFF3Loader.pm:415
>> STACK Bio::DB::SeqFeature::Store::Loader::do_load
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/Loader.pm:433
>> STACK Bio::DB::SeqFeature::Store::Loader::load_fh
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/Loader.pm:353
>> STACK Bio::DB::SeqFeature::Store::Loader::load
>> /opt/gbrowse/lib/perl5/Bio/DB/SeqFeature/Store/Loader.pm:243
>> STACK toplevel /opt/gbrowse/bin/bp_seqfeature_load.pl:252
>> ---------------------------------------------------
>>
>>
>> Thank you,
>>
>> -Emilio
>> ----------------------------------------------------------------------
>> -------- _______________________________________________
>> Gmod-gbrowse mailing list
>> Gmod-gbrowse <at> lists.sourceforge.net<mailto:Gmod-gbrowse <at> lists.sourcefor
>> ge.net><mailto:Gmod-gbrowse <at> lists.sourceforge.net>
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>>
>> <bpsl.log-1>
>>
>> <bpsl.log2><Gbrowse_NotFound_Error.png>
>
> <gbrowse_blankpage.png>
> ------------------------------------------------------------------------------
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse <at> lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse



 

--

------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

Attachment (GBrowse.conf): application/octet-stream, 12 KiB
Attachment (gerjam.conf): application/octet-stream, 6566 bytes
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Jeevan Karloss Antony Samy | 1 Dec 09:26 2015
Picon

GBrowse: Download Transcript Sequence

Is there a way (plugin) to download Transcript sequence from GBrowse? (e.g. ProteinDumper) 

Jeevan 
------------------------------------------------------------------------------
Go from Idea to Many App Stores Faster with Intel(R) XDK
Give your users amazing mobile app experiences with Intel(R) XDK.
Use one codebase in this all-in-one HTML5 development environment.
Design, debug & build mobile apps & 2D/3D high-impact games for multiple OSs.
http://pubads.g.doubleclick.net/gampad/clk?id=254741911&iu=/4140
L Shen | 25 Nov 02:21 2015
Picon

One MySQL performance issue

Hello:

I was trying most of the day to turning up my GBrowse instance which was extremely slow and always time-out.

I found that for some reason, the two  fields are not indexed by Gbrowse when creating the database tables:

table: feature
Fields: start,end

This caused significant slowness in my installation, where I have 54 millions rows in this table.

Indexing these 2 fields improved the speed for same query from 19.4 sec to 0.1 sec.

# original table schema:


CREATE TABLE `feature`
(   `id` int(10) NOT NULL AUTO_INCREMENT,   `typeid` int(10) NOT NULL,  
`seqid` int(10) DEFAULT NULL,  
`start` int(11) DEFAULT NULL, 
 `end` int(11) DEFAULT NULL, 
 `strand` tinyint(4) DEFAULT '0',  
`tier` tinyint(4) DEFAULT NULL, 
 `bin` int(11) DEFAULT NULL,  
`indexed` tinyint(4) DEFAULT '1',  
`object` mediumblob NOT NULL,  
PRIMARY KEY (`id`),  
KEY `seqid` (`seqid`,`tier`,`bin`,`typeid`),  
KEY `typeid` (`typeid`)
) ENGINE=MyISAM AUTO_INCREMENT=1371 DEFAULT CHARSET=latin1


If you faced same performance issue, you may want to check the index.


Lishuang Shen

------------------------------------------------------------------------------
Go from Idea to Many App Stores Faster with Intel(R) XDK
Give your users amazing mobile app experiences with Intel(R) XDK.
Use one codebase in this all-in-one HTML5 development environment.
Design, debug & build mobile apps & 2D/3D high-impact games for multiple OSs.
http://pubads.g.doubleclick.net/gampad/clk?id=254741551&iu=/4140
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Nalini Kanta Choudhury | 19 Nov 20:24 2015
Picon

relate to update protocol

Dear Sir,
             Is there any updated protocol for Gbrowse available for providing data from outside(not using example data)? Please send me the protocol for learning purpose.







Thanks & Regard
  NaliniKanta Choudhury
  IASRI,Library Avenue,
  New Delhi-1100120
------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
LE CAVORZIN Arnaud | 17 Nov 12:06 2015
Picon

Gbrowse_syn sequence name

I’m trying to load an alignment file into a mysql database, like describe in the tutorial.

 

My alignment file looks like :

 

CLUSTAL W(1.81) multiple sequence alignment W(1.81)

SpA-1(+)/1..231239   --------------------------------------------------

SpB-1(+)/1..231239   CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC

 

SpA-1(+)/1..231239   --------------------------------------------------

SpB-1(+)/1..231239   CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG

 

 

When using gbrowse_syn_load_alignments_msa.pl I have an error saying “I do not like the sequence name”. I have tried to change the name, but even if I used the same name as the tutorial I have the same error.

What I could do to import these data?

 

 

Thank you for your answer,

 

 

Best regards

 

 

 

Arnaud

------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
Jeevan Karloss Antony Samy | 12 Nov 22:29 2015
Picon

GMAP GFF3 File Not working

I uploaded GFF3 file from GMAP output to Custom tracks. It has more data in the last column than the normal
GFF3 file I use.

I want GBrowse to show exons and introns for mRNA. It shows the whole thing as a single continuous line. 

Any suggestion?

[mRNA_Test]
database = database_0 # do not change this!
feature      	  = mRNA:gadMor2
glyph              = so_transcript
bgcolor            = cyan
label_transcripts  = 1
draw_translation   = 1
label_transcripts  = 1
key                = Transcripts_Test
category    = Custom Tracks:Test.gff
show summary = 0

Jeevan
------------------------------------------------------------------------------
Emilio A. Alvarado Ortiz | 10 Nov 23:58 2015

Gbrowse_syn Help

Hello,

 

I have successfully installed and uploaded NGS data to Gbrowse. However, I would now like to upload a Multiple Alignment I had generated using the Chain/Net LASTZ pipeline. I have two MAF files I would like to visualize on GBrowse_syn.  Is there a pipeline I should follow or documentation showing the steps on how to upload my data into the Gbrowse_syn? I could only find the tutorials for the rice and wild rice. I would really appreciate your help.

 

 

Thank you,

 

-Emilio

------------------------------------------------------------------------------
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Gmane