Bingding Huang | 17 Sep 14:07 2014
Picon

[Biopython] PDBparser question

Dear All,
   Is that a way to get getting all the ligands residue name and their corresponding coordinates from a PDB File using  Bio.PDB.PDBParser ?
For example, for PDB ID 1F86, the ligand name is T44.

Many thanks
Bingding
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Bingding Huang | 17 Sep 09:49 2014
Picon

[Biopython] getting ligand residue name and coordinates from a PDB File

Dear All,
   Is that a way to get getting all the ligands residue name and their corresponding coordinates from a PDB File using  Bio.PDB.PDBParser ?
For example, for PDB ID 1F86, the ligand name is T44.

Many thanks
Bingding

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Sean Davis | 10 Sep 17:40 2014
Picon

[Biopython] [JOB] NIH-Wide Stadtman Tenure-Track Recruitment

The National Institutes of Health is now accepting applications for tenure-track positions through the Earl Stadtman recruitment mechanism.  Details are available here:  


Sean
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Peter Cock | 10 Sep 10:15 2014

[Biopython] Fwd: [Bosc-announce] Questionnaire about BOSC 2014 and 2015

Dear all,

If you attended the OBF run Bioinformatics Open Source Conference (BOSC)
this year, or might attend BOSC 2015 (or the Galaxy Community Conference,
GCC2015) please could you fill in this short survey.

Thank you,

Peter

---------- Forwarded message ----------
From: Nomi Harris <nlharris <at> gmail.com>
Date: Wed, Sep 10, 2014 at 2:32 AM
Subject: [Bosc-announce] Questionnaire about BOSC 2014 and 2015
To: bosc-announce <at> mailman.open-bio.org
Cc: BOSC 2014 <bosc <at> open-bio.org>

Hi all,

The BOSC organizing committee is looking into the possibility of
holding BOSC 2015 in Norwich, UK, just after GCC2015. We are seeking
feedback on that option, as well as more general feedback on BOSC 2014
(from those who didn’t attend it as well as those who did).

We've put together a short (5-minute) questionnaire to collect your
feedback--please go to http://bit.ly/BOSCsurvey to participate. The
deadline for submitting your response is Monday, September 15.

We appreciate your response, and hope to see you at BOSC 2015!

Sincerely,
       Nomi Harris and Peter Cock
       Co-Chairs, BOSC 2014 and BOSC 2015

_______________________________________________
Bosc-announce mailing list
Bosc-announce <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/bosc-announce

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Trevor Bell | 9 Sep 14:20 2014
Picon

[Biopython] SeqIO Note Field

Using the SeqIO example in Chapter 5 of the cookbook, I am able to read
entries from a .gb file of full GenBank records. Where can I find the "note"
field for the "source" entry?

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Jurgens de Bruin | 9 Sep 09:54 2014
Picon

[Biopython] large fasta files

Hi All,

I would like some advice on iterating over large fasta files 208MB  total of 1813132 sequences.  Currently using SeqIO.parse but seems very very slow. I would appreciate any help on this matter.


--
Regards/Groete/Mit freundlichen Grüßen/recuerdos/meilleures salutations/
distinti saluti/siong/duì yú/привет

Jurgens de Bruin
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Lior Glick | 7 Sep 11:25 2014
Picon
Picon

[Biopython] Nexus format dialects in Biopython

Dear list members,
I'm trying to convert newick formated trees to the nexus format. I'm doing this since I'd like to use the trees as input for a software (BayesTraits V2) which will only accept nexus trees. It also required that the file is in a specific dialect of nexus in which the taxa names are translated to numbers, and the trees themselves only contain these numbers.

I tried Bio.Phylo.convert(newick_trees_file,'newick',nexus_trees_file,'nexus'), but it produces nexus files with the taxa names within the trees. I couldn't find out a way to control the specific dialect of nexus to be used. Looking into the Bio.Nexus module wasn't very helpful either.

Does anybody know of a way to do that?

Thanks,
Lior
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Rojan Shrestha | 5 Sep 06:46 2014
Picon

[Biopython] Remove heteroatoms

Hello,

Can someone tell me about removing heteroatoms from PDB?

Here is the code for removing the heteroatoms I took from the link - http://pelican.rsvs.ulaval.ca/mediawiki/index.php/Manipulating_PDB_files_using_BioPython but it did not work. I have tested with 1C4R.pdb. It removes some water but some still remain in PDB.
for model in structure: for chain in model: for residue in chain: id = residue.id if id[0] != ' ': chain.detach_child(id) if len(chain) == 0: model.detach_child(chain.id)

Regards,

Rojan 
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Jakub Stanislaw Nowak | 4 Sep 18:13 2014
Picon
Picon

[Biopython] problem with ClustalW wrapper in Bio.Align.Applications

Hi biopython community,

Many thanks for the help me with a previous problem. It turned to be vital and help me move forward.
Unfortunately I have got another conundrum that I can't solve easily.

I am trying to use clustalW command tool in biopython on following set of sequences
{'pre-miR-344f': 'AGUCAGUCUCCUGGCUGGAGUCCAGCUCUAAGCUGGUUCCAGGCUCUAGCCAGGACCUGACUAC\n', 'pre-miR-9': 'UCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGU\r\n', 'pre-miR-210': 'CCGGGGCAGUCCCUCCAGGCUCAGGACAGCCACUGCCCACCGCACACUGCGUUGCUCCGGACCCACUGUGCGUGUGACAGCGGCUGA'}

First I processed them and converted them to fasta files using and saved into TL variable
def get_fasta_composite(self,name):
        self.name=name
        file_name=raw_input('How do you want call the file?')
        my_file = open(file_name + '.fasta', 'w')
        for key,values in self.name.items():
            my_file.write('>' + key + ' type ' + '\n' + self.name.get(key) + '\n')
            print('>' + key + ' type ' + '\n' + self.name.get(key))
        my_file.close()
        print('The file was saved as ' + file_name + '.fasta\n')
        depo = file_name + '.fasta'
        return depo

Output:

Saving Terminal loops

How do you want call the file?loops
>pre-miR-344f type 
CCAGCUCUAAGCUGGUUCCAGGC
>pre-miR-9 type 
GAGUGGUGUGGAGUCUUCAUA
>pre-miR-210 type 
CAGGACAGCCACUGCCCACCGCACACUGCGUUGCUCCGGACCCAC
The file was saved as loops.fasta

and the I used following command to produce alignment

#aligning TL
test3=tollbox()
attempt=test3.align(TL)
alignment=AlignIO.read(attempt, "clustal")
print(alignment)
print("\n")

and align method was defined as follows

def align(self, name):
        self.name=name
        print('This is alignment of '+self.name)
        cline = ClustalwCommandline("/Users/s1159142/clustalw_2.1/clustalw2", infile=self.name)
##        cline = ClustalwCommandline("/Users/user/BioinformaticsTools/clustalw_2.1", infile=self.name)
        output_file = self.name.rstrip("fasta")
        return output_file + "aln"

TL variable is ascribed by get_fasta_composite method from above
but unfortunately print(alignment) limits itself to only two first sequences from the loops.fasta file

this is output:

This is alignment of loops.fasta
SingleLetterAlphabet() alignment with 2 rows and 22 columns
CCAGCUCUAAGCUGGUUCCAGG pre-miR-344f
-GAGUGGUGUGGAGUCUUCAUA pre-miR-9

It is not the length of the last sequence. As I tried to substitute it for some similar and add also one more and I always got alignment of only first two sequences. 
I would be grateful if anyone can point the origin of problem.

Thanks,

Jakub

The University of Edinburgh is a charitable body, registered in
Scotland, with registration number SC005336.
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Jakub Stanislaw Nowak | 29 Aug 01:06 2014
Picon
Picon

[Biopython] alignment in biopython using `clustalW

Hello,

I am trying to run alignment using ClustalW in python.

I have used this code to compile

cline = ClustalwCommandline("clustalw2", infile="test.fasta")
print(cline)
stdout, stderr = cline()
align = AlignIO.read("test.aln", "clustal")
print(align)

But it is generating file. I think I have some problem with setting a proper pathway to  clustal.

This is the error:

clustalw2 -infile=test.fasta
Traceback (most recent call last):
  File "/Users/user/Google Drive/Bioinformatics/smallRNAseq/Python U densities/trial4old.py", line 95, in <module>
    stdout, stderr = cline()
  File "/Library/Frameworks/Python.framework/Versions/3.4/lib/python3.4/site-packages/Bio/Application/__init__.py", line 513, in __call__
    stdout_str, stderr_str)
Bio.Application.ApplicationError: Non-zero return code 127 from 'clustalw2 -infile=test.fasta', message '/bin/sh: clustalw2: command not found'


Can you suggest some solution?

Thanks,

Jakub


The University of Edinburgh is a charitable body, registered in
Scotland, with registration number SC005336.
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
def87 | 26 Aug 12:42 2014
Picon
Picon

[Biopython] phylo loop through nodes in tree

Hi,
 
I am trying to do a tree traversal with the phylo package (just loop over every node). I have read the tree into a Newick tree object. Now the class docu of TreeMixin shows me the available methods: _filter_search seems to be what I need because it says that it's for tree traversals. However I don't want to apply a filter because I want to loop over every node in the tree. That will probably be easy to realize after having understood how _filter_search works (something like filter = 1 = true for all = loop over all nodes). But there is no documentation for this function and I don't understand how it works by just reading what its arguments are:
_filter_search(self, filter_func, order, follow_attrs)
Could someone please tell me how to loop over every node (I need each node as a clade object, something like "for node in tree:")? I couldn't find anything regarding _filter_search in the cookbook.
 
Regards,
Robert
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython

Gmane