Riccardo | 26 Jan 19:36 2015
Picon

[Biopython] BioPython MMCIFParser.py chain.id

Hello to the BioPython mailing-list,
I'm using BioPython to calculate the dihedral angles in a protein together with the total number of residues for each chain; I made use of this construct for the total number of residues:

    resseq_list = []
    for residue in chain:
        #print residue
        residue_full_id = residue.get_full_id()
        #print residue_full_id
        resseq = residue_full_id[3][1]
        #print resseq
        resseq_list.extend([resseq])
    #print resseq_list
    print "\nThe first residue of chain %s is %s" % ( str(chain.id), resseq_list[0] )
    print "The last residue of chain %s is %s" % ( str(chain.id), resseq_list[-1] )
    print "The total number of residues into chain %s is %s\n" % ( str(chain.id), len(resseq_list) )

but the IDs for the chains differ from those shown, for example, in PyMOL.

Trying to figure out the cause, and comparing a PDB file with a CIF for the same macromolecule, I realized that the cause lies in the variables "_atom_site.label_asym_id" and "_atom_site.auth_asym_id" of CIF file, which correspond to columns [27:28] and [88:89] in the ATOM row of CIF file.

Reading here, and in particular "AddMMCifPDBChainTr (cif_chain_id, pdb_chain_id)", I thought that in practice the BioPython CIF parser considers "label_asym_id" instead of "auth_asym_id". So I opened the file MMCIFParser.py, and effectively I found, at line 37:

    chain_id_list=mmcif_dict["_atom_site.label_asym_id"]

I tried to replace it with:

    chain_id_list=mmcif_dict["_atom_site.auth_asym_id"]

and reloading my script, the output has been the same as the one reported by PyMOL, for some test CIF files, but not for all.

Is there an option, in BioPython, that enables the output directly in that format? Eventually, it might be a good idea to implement it, as seen in that web page?
Is there also another better way to know the total number of residues for each chain, such as in mine?

Thanks a lot, and many greetings to the BioPython mailing-list: this is my first time here!

Riccardo Volpe

X3D PyMOL Molecule Viewer (WebGL–powered)
ChemBioScripting | Gioacchino Riccardo Volpe
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Mario Pavone | 23 Jan 08:50 2015
Picon

[Biopython] AIS 2015 special issues in BMC Immunology & EAAI; 2 Keynote Speakers - 17-18 July 2015 Taormina, Italy


CALL FOR PAPERS, ABSTRACTS, ORAL/POSTER PRESENTATIONS
** Apologies for cross-posting **
** Please forward to anybody who might be interested. **


International Workshop on Artificial Immune Systems
- Systems & Synthetic Immunology, Computational Immunology &  
Immune-Inspired Engineering -
July 17-18, 2015 - Taormina, Italy

http://www.dmi.unict.it/ais2015/
ais2015 <at> ieee-cis-ais.org

*** AIS 2015 submission system is now open:  
http://www.dmi.unict.it/ais2015/submission.html

*** You are invited to submit papers to this exciting event! ***

*** The future seen together by Immunologists & Modellers! ***

--
**** PLENARY SPEAKERS: http://www.dmi.unict.it/ais2015/plenary.html

Alessandro SETTE, La Jolla Institute for Allergy & Immunology, La Jolla, USA

Hugues BERSINI, IRIDIA, Université Libre de Bruxelles, Belgium

**** SUBMISSION DEADLINE: 18th February 2015
http://www.dmi.unict.it/ais2015/dates.html

**** Special issues in: BMC IMMUNOLOGY and ENGINEERING APPLICATIONS OF  
ARTIFICIAL INTELLIGENCE, Elsevier

**** POST-PROCEEDING in IEEE Press or in Electronic Book:  
http://www.dmi.unict.it/ais2015/calls.html

** Paper Submission **

AIS 2015 includes three different types of submission:
1) *regular paper*: 8-pages maximum length, including figures, table &  
references. It should report on new and unpublished work;
2) *abstract*: no more than 2 pages length;
3) abstract for *Oral/Poster presentation* without IEEE proceeding: no  
pages restriction. It should discuss works in progress; new research  
ideas; works previously published elsewhere (it is essential that a  
reference to the previous article is clearly cited); and all that may  
be relevant and fruitful for soliciting discussions at the workshop.

** Venue & Accommodation **

The conference will be held in Taormina  
http://www.dmi.unict.it/ais2015/location.html

All information may be found at the following links:

http://www.dmi.unict.it/ais2015/venue.html
http://www.dmi.unict.it/ais2015/accommodation.html

-----

http://www.dmi.unict.it/ais2015/
ais2015 <at> ieee-cis-ais.org

AIS 2015 Submission Site
http://www.dmi.unict.it/ais2015/submission.html

Looking forward to welcoming you to Taormina in July 2015.
Carlos A. Coello Coello, Vincenzo Cutello, Doheon Lee, and Mario Pavone.

-- 
Dr. Mario Pavone (PhD)
Assistant Professor
Department of Mathematics and Computer Science
University of Catania
V.le A. Doria 6 - 95125 Catania, Italy
tel: 0039 095 7383038
fax: 0039 095 330094
Email: mpavone <at> dmi.unict.it
http://www.dmi.unict.it/mpavone/
===========================================================================
SSBSS 2015 - International Synthetic & Systems Biology Summer School
* Biology meets Engineering and Computer Science *
July 5-9, 2015 - Taormina, Italy
http://www.taosciences.it/ssbss2015/
===========================================================================
AIS 2015 - International Workshop on Artificial Immune Systems
* Systems & Synthetic Immunology, Computational Immunology,
                                            Immune-Inspired Engineering *
July 17-18, 2015 - Taormina, Italy
http://www.dmi.unict.it/ais2015/
===========================================================================
MOD 2015 - International Workshop on Machine Learning, Optimization & big Data
July 21-24, 2015 - Taormina, Italy
http://www.taosciences.it/mod-2015/
===========================================================================
12th European Conference on Artificial Life - ECAL 2013
September 2-6, 2013 - Taormina, Italy
http://mitpress.mit.edu/books/advances-artificial-life-ecal-2013
===========================================================================

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython

Jan Zaucha | 22 Jan 17:02 2015
Picon
Picon

[Biopython] Phylo.draw_graphviz(tree) not showing node names

Hi everyone,

I'm trying to visualize the trees I generate, but for some reason the plots do not display the node names. When I print the tree each node has an associated name (string format). Phylo.draw(tree) also works fine and plots a tree with the node names. 

I simply use:
Phylo.draw_graphviz(tree)
pylab.show()

There is no error, I can't work out how to force the node names to be printed. 

Any ideas?

Thanks,
Jan Zaucha

--
Jan Zaucha
Bristol Centre for Complexity Sciences
Computational Genomics Group
University of Bristol
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Björn Johansson | 12 Jan 18:30 2015
Picon

[Biopython] Finding genes with KEGG module

Hi,
I am interested in starting working with KEGG. I wonder if the Bio.KEGG module could be used to find all genes that encode enzymes that catalyze a specific reaction? Is there any tutorial on the module?

Thank you!
Bjorn Johansson

  






--
______O_________oO________oO______o_______oO__
Björn Johansson
Assistant Professor
Departament of Biology
University of Minho
Campus de Gualtar
4710-057 Braga
PORTUGAL
www.bio.uminho.pt
Google profile
Google Scholar Profile
my group
Office (direct) +351-253 601517 | (PT) mob.  +351-967 147 704 | (SWE) mob.  +46 739 792 968
Dept of Biology (secr) +351-253 60 4310  | fax +351-253 678980
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
assaf www | 21 Dec 12:09 2014
Picon

[Biopython] remote blast against SRA database with biopython

hi there,
I would like to use remote blast against SRA database
(http://www.ncbi.nlm.nih.gov/sra) with biopython, for specific
experiments

on the NCBI blast it is done from:
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&BLAST_SPEC=SRA&DB_GROUP=Exp

do you maybe have and idea whether this can be done with biopython ?
for example with NCBIWWW.qblast() or otherwise ?

thanks a lot
Assaf
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython

Jakub Stanislaw Nowak | 29 Nov 01:41 2014
Picon
Picon

[Biopython] RNA secondary structure with RNAfold

Hello everyone,

I am trying to model secondary structures of some RNA.

As I am not an expert in programming it is quite a challenge for me so far I found a way to access RNAfold from biopython via biomanycores.

I downloaded and installed both biomanycores and RNAfold tools in 
/usr/local/bin/

and wrote a simple test script in python before loading my dataset

from Biomanycores import RNAFold

RNA = 'CUGCAUUGGCCAAAUUGGCCCUACUACGUAUGCUAGCAUGAGAUGUGACAGUACAGUGUACUUAC'

structure = RNAFold.execute(RNA)

print(structure)

 
Unfortunately it hasn’t work and generated this error message:

Traceback (most recent call last):
  File "/Users/user/Google Drive/Bioinformatics/smallRNAseq/Python secondary structure/RNAFoldtest", line 9, in <module>
    structure = RNAFold.execute(RNA)
  File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Biomanycores-1.1210-py2.7.egg/Biomanycores/RNAFold.py", line 221, in execute
    handle, delta = rnafold_cmd.run(verbose=verbose)
  File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Biomanycores-1.1210-py2.7.egg/Biomanycores/AbstractCommandline.py", line 141, in run
    stderr=stderr_str)
ApplicationError: Non-zero return code 1 from '/usr/local/bin/RNAfold -f', message '/usr/local/bin/RNAfold: invalid option -- f'

>>> 

Do you know any solution for my problem? Alternatively maybe you know of some different approach to analyse secondary structure with biopython?

All best,

Jakub
The University of Edinburgh is a charitable body, registered in
Scotland, with registration number SC005336.
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Ivan Erill | 20 Nov 18:42 2014
Picon

[Biopython] NCBI e-utils parser upgrade

Hi all,

As part of my work, I need to deal with the new WP protein records at NCBI and, specifically, with the information on their coding sequences. This information is returned by E-utils through a an integrated protein report type of view:


which does not use a DTD for the XML, but rather a schema. Although there has been no formal announcement, I've been talking to NCBI people and they tell me that they will progressively be moving to schemas (which provide more fine grained validation specification). Specifically, all new XML exports from NCBI will be using schemas. I don't believe that existing DTDs are going to be replaced by schemas for now.

My original through was to branch an update for the current XML parser in BioPython, but it looks like using schemas would be a major overhaul of the existing code-base and it might make more sense to develop a parallel parser, so I first wanted to check on what approach you guys would prefer to do code-wise.

Regards,

Ivan

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Aisling O'Driscoll | 13 Nov 22:32 2014
Picon

[Biopython] Blast query

Hi,

I have a query re BLAST output. I have written a BioPython script that takes the attached betl gene sequence and runs a blast. It returns results for Listeria monocytogenes WSLC1001 complete genome with gi|584465821|gb|CP007160.1.

I run the same from the NCBI web interface just to verify the output and it also returns this result.

However why is it that it does not return the correct match of Listeria monocytogenes EGD-e chromosome with gi|16802048:2172068-2173591 as we can see at the top of the attached fasta file?

Thanks in advance
Aisling.
Attachment (betl.fasta): application/octet-stream, 2209 bytes
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Bhushan | 13 Nov 07:50 2014
Picon

[Biopython] How to apply symmetry matrix on protein chains

Hi,

I want to apply the symmetry matrix on pdb 1HRI and output the biological assembly (with rotated coordinates). Can anyone suggest me a way to do this using biopython.

Thank you for your time. I would appreciate any kind of help.


With Regards,
Bhushan.
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Radhouane Aniba | 13 Nov 01:08 2014
Picon

[Biopython] SeqIO __init__.py typo ?

Hello 

I was juste browsing the source to see how parse function is implemented and I found this before the docstring

def parse(handle, format, alphabet=None): r"""Turns a sequence file into an iterator returning SeqRecords. - handle - handle to the file, or the filename as a string (note older versions of Biopython only took a handle). - format - lower case string describing the file format. - alphabet - optional Alphabet object, useful when the sequence type cannot be automatically inferred from the file itself (e.g. format="fasta" or "tab") Typical usage, opening a file to read in, and looping over the record(s):
there is an r before the """

is that a typo ?

Rad
--
Radhouane Aniba
Bioinformatics Scientist
BC Cancer Agency, Vancouver, Canada
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Sanjeev Sariya | 7 Nov 15:55 2014

[Biopython] Error in pdb superimposer: global name Bio not defined

Hi Team,

I am trying to align 2 pdb files..
When I try to create an object for Bio.PDB.Superimposer(), I get a strange error.

Langauge specs:
Python version - 2.7
Bio.__version__ - 1.61 ## bio python version
My code looks like:

from Bio.PDB import *
def alignPDB_file(refPDB, samplePDB): # function to align pdb file
     ref_atoms,sample_atoms=[],[]

     ref_model=PDBParser(QUIET=True).get_structure("reference",refPDB)[0] # get the 0th model
     sam_model=PDBParser(QUIET=True).get_structure("sample",samplePDB)[0] # get the 0th model

     for ref_chain in ref_model:
          for ref_res in ref_chain:
               if not "CA" in ref_res:continue
               else:  ref_atoms.append(ref_res['CA'])

     for sam_chain in sam_model:
          for sam_res in sam_chain:
               if not "CA" in sam_res: continue
               else: sample_atoms.append(sam_res['CA'])

     #super_imposer=Bio.PDB.Superimposer()
     super_imposer = Bio.PDB.Superimposer()


Error:
    super_imposer = Bio.PDB.Superimposer()
NameError: global name 'Bio' is not defined

Kindly advise.

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython

Gmane