Francesco Strozzi | 30 Jul 10:46 2014
Picon

[Biopython] EU OBF Codefest - September 18th and 19th 2014 <at> EBI - Hinxton UK

Dear all,
apologies if you receive this multiple times.

We are glad to announce that we are organising the European edition of
the OBF Codefest, which will take place on September 18th and 19th at
the EBI in Hinxton, UK. This is the second OBF Codefest this year, the
first was held this month in Boston just before the BOSC and ISMB
conferences and in September we will have the chance to expand and
carry on the work and discussions started in July in the USA.

The EU Codefest will precede the Genome
Informatics Conference in Cambridge, so we hope that developers
attending the main conference will be also interested in joining us
for a couple of days of coding and discussions on collaborative
projects and new ideas. The main topics that were proposed so far are:

* The OpenBio projects development (BioPerl, BioPython, BioRuby, BioJava)
* Semantic web technologies for biological data (e.g. RDF, OWL)
* Software deployment and bioinformatics pipelines, including
CloudBiolinux, Docker and GNU GUIX
* NoSQL databases and NGS data mining
* Biological data visualisation with e.g. D3/JS and BioJS.

We of course invite attendees to add other topics of interest.

For more information, you can visit the OBF Wiki page, which includes
also information on accommodation and registration:
http://www.open-bio.org/wiki/EU-Codefest_2014
If you plan to attend, please use the link in the registration section
and complete the simple steps on the EBI website, so that
(Continue reading)

Ilya Flyamer | 25 Jul 14:55 2014
Picon

[Biopython] Edit feature's location

Hi,

is there a way to either change SeqFeature's location in place or create a copy with a different location? Assigning to feature.location.start raises an AttributeError.

My ultimate goal is to move all features in a genbank file by some specific number of nucleotides (for example, add 1000 to all coordinates). If someone can help me and tell about an easier way, I will appreciate it.

Best,
Ilya
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Frederico Moraes Ferreira | 22 Jul 20:14 2014
Picon
Picon

[Biopython] PDB parser: suppress warnings

Hi Biopythonees,
Has anybody happen to know how to suppress warnings when reading PDBs 
with hydrogenated waters?

from Bio.PDB.PDBParser import PDBParser
struct = PDBParser().get_structure('tmp', pdbf)

My PDBs came from MD so as all water molecules have hydrogens causing 
thousands of warnings like:
...
/usr/lib64/python2.7/site-packages/Bio/PDB/PDBParser.py:284: 
PDBConstructionWarning: PDBConstructionException: Atom 2H defined twice 
in residue <Residue HOH het=W resseq=2640 icode= > at line 71037.
Exception ignored.
Some atoms or residues may be missing in the data structure.
   % message, PDBConstructionWarning)
...

Thanks in advance.
Fred

--

-- 
Dr. Frederico Moraes Ferreira
University of Sao Paulo
Heart Institute, School of Medicine
Laboratoy of Immunology
Av. Dr. Enéas de Carvalho Aguiar, 44
05403-900     Sao Paulo - SP
Brasil

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython

Mark Budde | 16 Jul 21:03 2014
Picon

[Biopython] upgrade problems on Mac

Hi all,
I am trying to upgrade to the current version on my Mac, but get an error. I've tried the suggestions online about

$ xcode-select --install

but that doesn't work.

I'm running enthought 2.7 (Python 2.7.3 -- EPD 7.3-2 (32-bit)) on OSX Version 10.9.3

Any help would be much appreciated.

Thanks,

-Mark


Here is what my session looks like:

*****************************

Marks-MacBook-Pro-3:biopython-1.64 markbudde$ sudo python setup.py install

Password:

running install

running build

running build_py

running build_ext

building 'Bio.cpairwise2' extension

Compiling with an SDK that doesn't seem to exist: /Developer/SDKs/MacOSX10.5.sdk

Please check your Xcode installation

gcc -DNDEBUG -g -O3 -arch i386 -isysroot /Developer/SDKs/MacOSX10.5.sdk -Qunused-arguments -Qunused-arguments -I/Library/Frameworks/Python.framework/Versions/7.3/include/python2.7 -c Bio/cpairwise2module.c -o build/temp.macosx-10.5-i386-2.7/Bio/cpairwise2module.o

clang: warning: no such sysroot directory: '/Developer/SDKs/MacOSX10.5.sdk'

In file included from Bio/cpairwise2module.c:12:

/Library/Frameworks/Python.framework/Versions/7.3/include/python2.7/Python.h:33:10: fatal error: 'stdio.h' file not found

#include <stdio.h>

         ^

1 error generated.

error: command 'gcc' failed with exit status 1



_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Evan Parker | 16 Jul 19:24 2014
Picon

[Biopython] GSoC Biopython project update

Hello fellow Biopythoneers and OBF-SoC students,

I have a new blog post regarding my ongoing work with the lazy-loading and indexing sequence file parser. I've been stabilizing and testing the GenBank parser this last week. You can always check out my github commit log if you want to see the most recent changes.

- Evan Parker.
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
halima saker | 11 Jul 13:23 2014
Picon

[Biopython] blast against genomes in biopython

from Bio import Entrez, SeqIO from Bio.Blast import NCBIXML from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]') blast_records = NCBIXML.parse(result_handle) for blast_record in blast_records: for alignment in blast_record.alignments: for hsp in alignment.hsps: print(hsp.query[0:75] + '...') print(hsp.match[0:75] + '...') print(hsp.sbjct[0:75] + '...')



this does not give me an output, although the sequence is actually a sequence of the genome, so i must get a result. where is the error? the query is correct?
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Kenan Azam | 7 Jul 20:07 2014
Picon

[Biopython] Retrieving protein transcripts for a protein coding gene

Hi there,

I am using biopython's wrapper API for ncbi eutils to retrieve related proteins, identical proteins and variant proteins (transcripts, splice variants, etc) for a certain protein coding gene. 

This information is displayed for a protein coding gene on its ncbi page under the "mRNA and Protein(s)" section

http://www.ncbi.nlm.nih.gov/gene/10555

I am retrieving identical proteins via LinkName=protein_protein_identical and related via LinkName=protein_protein

http://www.ncbi.nlm.nih.gov/protein?LinkName=protein_protein_identical&from_uid=69122971

Is there a way to retrieve the transcripts for a protein coding gene?

Thank you, K

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Evan Parker | 2 Jul 19:01 2014
Picon

[Biopython] GSoC Biopython update:

Hello fellow Biopythoneers and OBF-SoC students,

I have a new blog post regarding my ongoing work with the GenBank file format. You can always check out my github repository if you want to see my most recent commits.

-Evan Parker
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Ismail Uddin | 29 Jun 12:43 2014
Picon

[Biopython] FASTA file parsing

Dear Sir or Madam,

I would like to post a question regarding FASTA file parsing using the BioPython module. The current tutorial online indicates how to parse a FASTA file, but the output is in the format Seq('<<sequence here>>', SingleLetterAlphabet())

I would like to know how one may simply print out the entire sequence without any adjoining text i.e. 'ACTACGGCGAT'

I ask this question, as I am trying to write a script that will read each entry in the FASTA file and produce a dictionary of key being the ID and the value being the raw sequence.

​Thank you in advance for your help and cooperation,
Ismail Uddin
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
João Rodrigues | 26 Jun 11:31 2014
Picon

Re: [Biopython] Merging different pdbs into a single object structure and writing it

Good to hear ! ​
_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython
Claudia Millán Nebot | 25 Jun 17:48 2014
Picon

[Biopython] Merging different pdbs into a single object structure and writing it

Hi :) I'm newbie to BioPython and I am trying to do the following:

I have a set of different pdbs that I want to merge together into a single file. I would like to take into consideration that there could be issues with the naming, so, after reading a few other posts in this same list, I came up with the following code:

            list_parsers=[]
            list_of_structures=[]
            for index in range(len(list_of_filenames)):
                parser=PDBParser()
                list_parsers.append(parser)
                structure=parser.get_structure(list_of_filenames[index][:-4],list_of_filenames[index])
                list_of_structures.append(structure)
            i_chain = 65
            for structure in list_of_structures:
              for chain in structure:
                chain.id = chr(i_chain)
                i_chain += 1
            io=PDBIO()    
            for structure in list_of_structures:
                io.set_structure(structure)
            io.save(clust_fold+key[:-4]+"_fused.pda")

This is not working, as I guess i'm just changing the structure set each time I do  io.set_structure, and writing the last one. And as there is not such a thing as the append_structure() method I have just tried a silly thing. So my question would be which is the best way to get the pdbs merged? Should I save as independent unfold entities and then write them by using a Select class?

Thanks in advance and regards,

Claudia Millán (cmncri <at> ibmb.csic.es)

Crystallographic Methods Group

http://chango.ibmb.csic.es

Institut de Biologia Molecular de Barcelona (IBMB-CSIC)

Barcelona, Spain

_______________________________________________
Biopython mailing list  -  Biopython <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biopython

Gmane