headers
bugzilla-daemon | 1 Nov 2008 05:02

[Bug 2627] Updated Bio.MarkovModel to remove oldnumeric and listfns imports

http://bugzilla.open-bio.org/show_bug.cgi?id=2627

mdehoon <at> ims.u-tokyo.ac.jp changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|NEW                         |RESOLVED
         Resolution|                            |FIXED

------- Comment #3 from mdehoon <at> ims.u-tokyo.ac.jp  2008-11-01 00:02 EST -------
I made some changes to this patch and committed it to CVS; see MarkovModel.py
revision 1.9.

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 0 comments |
headers
bugzilla-daemon | 1 Nov 2008 06:38

[Bug 2631] Updated Bio.MaxEntropy to remove listfns import

http://bugzilla.open-bio.org/show_bug.cgi?id=2631

mdehoon <at> ims.u-tokyo.ac.jp changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|NEW                         |RESOLVED
         Resolution|                            |FIXED

------- Comment #5 from mdehoon <at> ims.u-tokyo.ac.jp  2008-11-01 01:38 EST -------
Committed to CVS with some changes; see MaxEntropy.py versions 1.8 and 1.9.
I added your example at the bottom of Bio/MaxEntropy.py.
Next time, instead of the complete new code for a module, please attach a patch
instead. Thanks!

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 0 comments |
headers
bugzilla-daemon | 1 Nov 2008 07:59

[Bug 2629] Updated Bio.NaiveBayes to listfns import

http://bugzilla.open-bio.org/show_bug.cgi?id=2629

------- Comment #3 from mdehoon <at> ims.u-tokyo.ac.jp  2008-11-01 02:59 EST -------
I committed part of this patch to CVS; see NaiveBayes.py revision 1.9.
Could you check your classify function? It seems to contain some debugging
statements. Also, do we need the classifyprob function?
If you send in a new version of this code, please attach it as a patch to the
current version of NaiveBayes.py in CVS.
Thanks!

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 0 comments |
headers
bugzilla-daemon | 1 Nov 2008 22:22

[Bug 2592] numpy migration for Bio.PDB.Vector

http://bugzilla.open-bio.org/show_bug.cgi?id=2592

biopython-bugzilla <at> maubp.freeserve.co.uk changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
             Status|NEW                         |RESOLVED
         Resolution|                            |FIXED

------- Comment #2 from biopython-bugzilla <at> maubp.freeserve.co.uk  2008-11-01 17:22 EST -------
Fixed in CVS, see Bio/PDB/Vector.py revision 1.45

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 0 comments |
headers
bugzilla-daemon | 1 Nov 2008 23:11

[Bug 2381] translate and transcibe methods for the Seq object (in Bio.Seq)

http://bugzilla.open-bio.org/show_bug.cgi?id=2381

------- Comment #26 from biopython-bugzilla <at> maubp.freeserve.co.uk  2008-11-01 18:11 EST -------
Here is an example of how the updated Seq object might be used (taken from the
new edition of the tutorial in CVS):

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", IUPAC.unambiguous_dna)
>>> coding_dna.translate()
Seq('MAIVMGR*KGAR*', HasStopCodon(IUPACProtein(), '*'))
>>> coding_dna.translate(to_stop=True)
Seq('MAIVMGR', IUPACProtein())

Using the Vertebrate Mitochondrial table instead:

>>> coding_dna.translate(table="Vertebrate Mitochondrial")
Seq('MAIVMGRWKGAR*', HasStopCodon(IUPACProtein(), '*'))
>>> coding_dna.translate(table=2)
Seq('MAIVMGRWKGAR*', HasStopCodon(IUPACProtein(), '*'))
>>> coding_dna.translate(table=2, to_stop=True)
Seq('MAIVMGRWKGAR', IUPACProtein())

As I said in comment 24, the name "to_stop" and its behaviour are taken from
the old (now obsolete) Bio.Translate module.

-------------------------------------------------------------

I'm also considering adding an additional boolean argument too (see comment
22):
(Continue reading)

Permalink | Reply | 0 comments |
headers
bugzilla-daemon | 3 Nov 2008 12:17

[Bug 2638] New: test_PopGen_SimCoal_nodepend.py fails on Windows do to newline issue

http://bugzilla.open-bio.org/show_bug.cgi?id=2638

           Summary: test_PopGen_SimCoal_nodepend.py fails on Windows do to
                    newline issue
           Product: Biopython
           Version: Not Applicable
          Platform: PC
        OS/Version: Windows
            Status: NEW
          Severity: normal
          Priority: P2
         Component: Unit Tests
        AssignedTo: biopython-dev <at> biopython.org
        ReportedBy: biopython-bugzilla <at> maubp.freeserve.co.uk

This unit test attempts to regenerate a plain text SimCoal file, and currently
fails on Windows (but passes on Linux and Mac OS X).

Patch to follow.

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 3 comments |
headers
bugzilla-daemon | 3 Nov 2008 12:22

[Bug 2638] test_PopGen_SimCoal_nodepend.py fails on Windows do to newline issue

http://bugzilla.open-bio.org/show_bug.cgi?id=2638

------- Comment #1 from biopython-bugzilla <at> maubp.freeserve.co.uk  2008-11-03 06:22 EST -------
Created an attachment (id=1030)
 --> (http://bugzilla.open-bio.org/attachment.cgi?id=1030&action=view)
Patch to the PopGen/SimCoal/Template.py and the unit test

Looking at the code, rather than using \n to mean a platform aware new line,
\r\n is used (this doesn't always give a CR LF, but on Windows you get CR CR LF
instead).

Also, are the template files in CVS as plain text files or binary files?  I
haven't double checked but I think they may be checked in as binary files with
DOS/Windows new lines...

I haven't committed this as I don't have SIMCOAL installed to check there are
no side effects.

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 0 comments |
headers
bugzilla-daemon | 3 Nov 2008 12:22

[Bug 2638] test_PopGen_SimCoal_nodepend.py fails on Windows, newline issue

http://bugzilla.open-bio.org/show_bug.cgi?id=2638

biopython-bugzilla <at> maubp.freeserve.co.uk changed:

           What    |Removed                     |Added
----------------------------------------------------------------------------
            Summary|test_PopGen_SimCoal_nodepend|test_PopGen_SimCoal_nodepend
                   |.py fails on Windows do to  |.py fails on Windows,
                   |newline issue               |newline issue

------- Comment #2 from biopython-bugzilla <at> maubp.freeserve.co.uk  2008-11-03 06:22 EST -------
Removed typo in the bug summary (title).

--

-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.
Permalink | Reply | 0 comments |
headers
Peter | 3 Nov 2008 12:48
Picon
Picon

Re: New line issues in the source zip or tarballs

On Mon, Sep 8 Peterwrote:
> Tiago wrote:
>> Peter wrote:
>>> In the case of test_PopGen_SimCoal_nodepend.py the failure is
>>> expecting simple.par and simple_100_30.par to be exactly the same size
>>> (in class TemplateTest, line 47).  This is not true going to be true
>>> when the input file uses Unix new lines but the generated file uses
>>> Windows new lines.  Perhaps using a simple bit of code to load the
>>> files line by line and compare them would work here?
>>
>>  I am currently at a workshop (I belong to the organization committee, so I
>> don't have much time), but I will try to sort this in the next couple of
>> days.
>
> This issue new line issue has probably been there since Biopython 1.45
> without anyone else spotting it, so I don't see fixing it as urgent.
> Hopefully we can resolve this for the next release instead.

I've filed Bug 2638 on this with a possible patch.  Could you take a
look at this please?

I just tried installing SIMCOAL2 on my Mac, but failed.  To be fair,
they do only appear to support Linux and Windows...

Thanks

Peter
Permalink | Reply | 0 comments |
headers
Peter | 3 Nov 2008 13:43
Picon
Picon

Bio.PopGen and SIMCOAL2 installation

Hi Tiago,

I've just compiled SIMCOAL2 on a Linux machine from
http://cmpg.unibe.ch/software/simcoal2/ (version 2.1.2).  If anyone
else tries this, it required the use of -fpermissive on g++ 4.1.2 to
compile (and gave lots of deprecation warnings, plus some trivial ones
about header files which didn't end with a newline).

The make file specifies the executable name as simcoal2_1_2, however
it does not include an install target, so it is up to the user where
to put the binary (e.g. I used ~/bin/ rather than system wide) and
perhaps what to call it.  The provided pre-compiled binary is also
called simcoal2_1_2.

However, Bio.PopGen.SimCoal.Controller seems to assume the executable
will be called just simcoal2 (or simcoal2.exe on Windows), and thus
fails detect a binary called simcoal2_1_2.  The unit test however is
more flexible and looks for any binary on the path whose name starts
with simcoal2.  Ideally these two should be consistent.

I can make test_PopGen_SimCoal.py pass by installing SIMCOAL2 as
simcoal2 rather than simcoal2_1_2, but is this a SIMCOAL2 installation
issue or a bug in Bio.PopGen.SimCoal.Controller?  In my experience it
is not normal for a Linux tool to include the full version in the
executable name - using just simcoal2 does make more sense.

Thanks,

Peter
(Continue reading)

Permalink | Reply | 2 comments |

Gmane