headers
Liam Elbourne | 5 Nov 10:04
Picon
Picon
Favicon

Re: searchio tags

Thanks Jason and Chris,

I ended up iterating through the features as I needed the locus_tag  
anyway - bit slow but gets there in the end...

I've ccd this to the bioperl list as suggested, and will subscribe soon.

Regards,
Liam.

On 05/11/2008, at 6:00 AM, Chris Fields wrote:

> I've already looked into that using TBLASTN output from the web  
> interface, but I found no relevant lines in HSP sections in XML  
> formatted reports (see below).  It is possible the URLAPI interface  
> is returning different XML data (I've seen stranger things from  
> NCBI).  I'll check into that when I can.  BTW, the default read  
> format for RemoteBlast is still text IIRC (we never changed it to  
> XML), so is it possible Liam is referring to the default (text)  
> output, and not XML?
>
> Also, I have managed to get this working in GenericHSP, will  
> probably commit momentarily with added tests.  Liam, if you have XML  
> output that contains the relevant data could you attach it to an  
> email so I can try parsing it out?
>
> Liam, it might be best to ask these questions on the mail list in  
> case Jason or I can't get to them immediately.  For SeqIO features,  
> in order to retrieve a particular feature region you would need to  
> either iterate through or grep the relevant features and retrieve
(Continue reading)

Permalink | Reply | 0 comments |
headers
Mark Blaxter | 5 Nov 16:05
Picon
Picon

bioperl on osX 10.5

Hi BioPerl team

in installing BioPerl with cpan on macOSX 10.5 ( "cpan>force install S/ 
SE/SENDU/bioperl-1.5.2_102.tar.gz" ) I got these errors that looked  
more worrying than the remainder....
FYI, as I think bioperl works (or at least the bits I am using...)

thanks for all the work!
mark

------------- EXCEPTION  -------------
MSG: No flatfile fileid files in config - check the index has been  
made correctly
STACK Bio::DB::Flat::BinarySearch::read_config_file /Users/mblaxter/ 
Library/Application Support/.cpan/build/bioperl-1.5.2_102-vnU6b6/blib/ 
lib/Bio/DB/Flat/BinarySearch.pm:1288
STACK Bio::DB::Flat::BinarySearch::new /Users/mblaxter/Library/ 
Application Support/.cpan/build/bioperl-1.5.2_102-vnU6b6/blib/lib/Bio/ 
DB/Flat/BinarySearch.pm:276
STACK Bio::DB::Flat::new /Users/mblaxter/Library/Application  
Support/.cpan/build/bioperl-1.5.2_102-vnU6b6/blib/lib/Bio/DB/Flat.pm:177
STACK Bio::DB::Flat::new_from_registry /Users/mblaxter/Library/ 
Application Support/.cpan/build/bioperl-1.5.2_102-vnU6b6/blib/lib/Bio/ 
DB/Flat.pm:252
STACK (eval) /Users/mblaxter/Library/Application Support/.cpan/build/ 
bioperl-1.5.2_102-vnU6b6/blib/lib/Bio/DB/Registry.pm:164
STACK Bio::DB::Registry::_load_registry /Users/mblaxter/Library/ 
Application Support/.cpan/build/bioperl-1.5.2_102-vnU6b6/blib/lib/Bio/ 
DB/Registry.pm:163
STACK Bio::DB::Registry::new /Users/mblaxter/Library/Application
(Continue reading)

Permalink | Reply | 0 comments |
headers
Dan Bolser | 7 Nov 15:27
Picon
Gravatar

Problems with Bio::SearchIO

Hi,

I'm new to BioPerl, so apologies if I'm doing something wrong. Please
just let me know what I'm doing wrong or what you need.

I downloaded the latest BioPerl via SVN (revision 14980), and did the,

perl Build.PL
./Build test
./Build install

(note that I have lib::local installed, pointing things at ~/perl5)

I ignored the failed tests, as-per the "everyone who is l88t does
this" instructions ;-)

I am trying to parse the output of a "blastall -p blastn" job
(blastall 2.2.18) using either the default format or tabular format. I
copied the "search_overview.PLS" script found here:

http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/scripts/graphics/search_overview.PLS

My code looks like this:

my $parser =
  new Bio::SearchIO(
    -format => 'blasttable',
    -file   => 'my.blast.m8.out' );

warn "parsed (", $parser->result_count(), ")\n";
(Continue reading)

Permalink | Reply | 502 comments |
headers
Tristan Lefebure | 7 Nov 21:59
Picon

SeqIO & multi-line fastq

Hi there,

I'm parsing with SeqIO a FastQ file made by MAQ. SeqIO complains because
this is a multiline fastq file. By looking at the Bio::SeqIO::fastq,
it's pretty obvious that it can't handle multilines. Who is wrong? MAQ,
SeqIO, or am I missing something?

Some more details below:

###
[tristan <at> trudy maq_easyrun] seq2seq.pl cns.fq fastq cns.fna fasta

------------- EXCEPTION -------------
MSG: AACTATTTATCAAATTTAAAATTCAACGAAAAACAAAGCAAAGCAGATCTTTTAGTTTTT
doesn't match fastq descriptor line type
STACK
Bio::SeqIO::fastq::next_seq /usr/local/share/perl/5.10.0/Bio/SeqIO/fastq.pm:113
STACK toplevel /home/tristan/bin/seq2seq.pl:25
-------------------------------------
###

The fastq file looks like that:
-----------
@nctc11168
atgAATCCAAGCCAAATACTTGAAAATTTAAAAAAAGAATTAAGTGAAAACGAATACGAA
AACTATTTATCAAATTTAAAATTCAACGAAAAACAAAGCAAAGCAGATCTTTTAGTTTTT
AATGCTCCAAATGAACTCATGGCTAAATTCATACAAACAAAATACGGCAAAAAAATCGCG
CATTTTTATGAAGTGCAAAGCGGAAATAAAGCCATCATAAATATACAAGCACAAAGTGCT
AAACAAAGCAACAAAAGCACAAAAATCGACATAGCTCATATAAAAGCACAAAGCACGATT
TTAAATC[...]
(Continue reading)

Permalink | Reply | 1 comment |
headers
Chris Fields | 7 Nov 22:31
Favicon
Gravatar

Re: Problems with Bio::SearchIO

On Nov 7, 2008, at 8:27 AM, Dan Bolser wrote:

> Hi,
>
> I'm new to BioPerl, so apologies if I'm doing something wrong. Please
> just let me know what I'm doing wrong or what you need.
>
>
> I downloaded the latest BioPerl via SVN (revision 14980), and did the,
>
> perl Build.PL
> ./Build test
> ./Build install
>
> (note that I have lib::local installed, pointing things at ~/perl5)
>
> I ignored the failed tests, as-per the "everyone who is l88t does
> this" instructions ;-)

SearchIO (specifically, HSP methods used to calculate seq start/end  
correctly) are being revised in svn, so they are failing at the  
moment.  My local (not-yet-committed) revisions are failing much more,  
but that's b/c the tests are wrong; these should be added in  
relatively soon once I work out more kinks in the code.

> I am trying to parse the output of a "blastall -p blastn" job
> (blastall 2.2.18) using either the default format or tabular format. I
> copied the "search_overview.PLS" script found here:
>
> ...
(Continue reading)

Permalink | Reply | 502 comments |
headers
Joel Martin | 7 Nov 23:45
Favicon

Re: SeqIO & multi-line fastq

Hello,
   multiline fastq seems broken by design, @ is a quality score
and also the id delimiter.  the script accompanying maq for converting
fastq to fasta can't parse the multiline fastq output by maq, so I'd
say it's maq that's wrong.
   I did this to parse them, but wasn't sure enough about /^\+/ to 
suggest it for bioperl.

while (<$fh>) {
  if (/^@(\S+)/) {         # read name
    print ">$1\n";

    my $lines = 0;

    while ( <$fh> ) {      # read sequence
      if ( ! (/^\+/) ) {   # stop at '+' line
        print;
        $lines++;
      }
      else {
        last;
      }
    }
    while ( $lines-- ) {  # skip quals
      <$fh>;
    }
  }
}

Joel
(Continue reading)

Permalink | Reply | 0 comments |
headers
Lincoln Stein | 10 Nov 21:25
Picon
Gravatar

Withdraw Bio::Graphics and Bio::DB::SeqFeature from bioperl distribution?

Hi All,

The glacial pace of official bioperl releases is interfering with my ability
to package GBrowse 2.00 into debian and rpm packages. Is there any objection
if I withdraw Bio::Graphics and Bio::DB::SeqFeature from the bioperl
distribution and turn them into independent CPAN modules?

Thanks,

Lincoln

--

-- 
Lincoln D. Stein

Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Stacey Quinn <Stacey.Quinn <at> oicr.on.ca>

Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724 USA
(516) 367-8380
Assistant: Sandra Michelsen <michelse <at> cshl.edu>
Permalink | Reply | 35 comments |
headers
Scott Cain | 10 Nov 21:50
Picon

Re: Withdraw Bio::Graphics and Bio::DB::SeqFeature from bioperl distribution?

Hi Lincoln,

Interesting idea; I'm sure you've already spent some time thinking it
through, but presumably there are a fair amount of dependencies from
Bio::Graphics and SeqFeature::Store to other parts of BioPerl.  How
much of a hassle do you think will be introduced by this bifurcation?

Scott

On Mon, Nov 10, 2008 at 3:25 PM, Lincoln Stein <lincoln.stein <at> gmail.com> wrote:
> Hi All,
>
> The glacial pace of official bioperl releases is interfering with my ability
> to package GBrowse 2.00 into debian and rpm packages. Is there any objection
> if I withdraw Bio::Graphics and Bio::DB::SeqFeature from the bioperl
> distribution and turn them into independent CPAN modules?
>
> Thanks,
>
> Lincoln
>
> --
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn <at> oicr.on.ca>
>
(Continue reading)

Permalink | Reply | 0 comments |
headers
Chris Fields | 10 Nov 22:46
Favicon
Gravatar

Re: Withdraw Bio::Graphics and Bio::DB::SeqFeature from bioperl distribution?

Lincoln,

I agree about the glacial pace.  It's also feeling more and more like  
only a couple of active developers are working on it (so the more that  
chip in the better).  Furthermore, the code base is so large now at  
this point it feels like steering an aircraft carrier with an oar and  
has become very hard to work on.

I don't have any objections personally if you want to withdraw  
Bio::Graphics/Bio::DB::SeqFeature, but how much work would that be  
(scott mentions a few issues I see)?

Personally, I think if Bio::Graphics remains in bioperl we have to do  
two things.  We should release the full bioperl-live as-is to CPAN as  
an official release (TODO any bugs) ASAP.  No RCs; we'll post point  
releases along the way for bug fixes (I like the 'release early/ 
release often' mantra).  I can work on this over the next couple of  
weeks, aiming for Thanksgiving for a 1.6, but I probably won't get  
rolling until this weekend (too much going on this week).  We can aim  
for more regular point releases then.

Following that, I think a more stable long-term solution is to split  
off some of the non-core-like modules so that we can speed up releases  
(this has been discussed in the past, http://www.bioperl.org/wiki/Proposed_1.6_core_modules) 
.  Basically, make a 'bare-bones' well-tested core containing the base  
classes and interfaces that remain stable long-term, such as  
Bio::Root, Bio::Seq/PrimarySeq, Bio::SeqFeature::*, with as few  
dependencies as possible.

Everything else requiring constant maintenance, not actively
(Continue reading)

Permalink | Reply | 28 comments |
headers
Dan Bolser | 10 Nov 23:01
Picon
Gravatar

Re: Withdraw Bio::Graphics and Bio::DB::SeqFeature from bioperl distribution?

2008/11/10 Chris Fields <cjfields <at> illinois.edu>:
> Lincoln,
>
> I agree about the glacial pace.  It's also feeling more and more like only a
> couple of active developers are working on it (so the more that chip in the
> better).  Furthermore, the code base is so large now at this point it feels
> like steering an aircraft carrier with an oar and has become very hard to
> work on.
>
> I don't have any objections personally if you want to withdraw
> Bio::Graphics/Bio::DB::SeqFeature, but how much work would that be (scott
> mentions a few issues I see)?
>
> Personally, I think if Bio::Graphics remains in bioperl we have to do two
> things.  We should release the full bioperl-live as-is to CPAN as an
> official release (TODO any bugs) ASAP.  No RCs; we'll post point releases
> along the way for bug fixes (I like the 'release early/release often'
> mantra).  I can work on this over the next couple of weeks, aiming for
> Thanksgiving for a 1.6, but I probably won't get rolling until this weekend
> (too much going on this week).  We can aim for more regular point releases
> then.
>
> Following that, I think a more stable long-term solution is to split off
> some of the non-core-like modules so that we can speed up releases (this has
> been discussed in the past,
> http://www.bioperl.org/wiki/Proposed_1.6_core_modules).  Basically, make a
> 'bare-bones' well-tested core containing the base classes and interfaces
> that remain stable long-term, such as Bio::Root, Bio::Seq/PrimarySeq,
> Bio::SeqFeature::*, with as few dependencies as possible.
>
(Continue reading)

Permalink | Reply | 2 comments |

Gmane