headers
Jason Stajich | 1 Sep 09:42
Gravatar

Re: Bio::Tools::dpAlign feature request

Safe to ignore the tests.  Those that are failing aren't even test for  
Bio::Align::dpAlign - but were written to test a bug that has not been  
fixed in the EVD module if I remember correctly that is why they are  
marked in a TODO block, but I can't tell if the Test.pm is actually  
skipping these tests or not.

I think we probably need to deprecate some of these modules as there  
is no maintainer of Ewan's code in here.

At a minimum we need to modularlize the tests for these modules into  
separate t dir and fix the need for multiple Makefile.PL in here and  
probably move to Build.PL

-jason
On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:

>
> Hi Alexie
>
> My understanding is that you can ignore these failures.
>
> I believe test cases 17-20 were added by Jason Stajich before I  
> added the feature you requested. I am not sure what he was doing  
> there.
>
> I suppose he can give you the definite answer to whether this is  
> something important or not.
>
> By the way, did you try out the new feature? Does it work?
>
(Continue reading)

Permalink | Reply | 1 comment |
headers
Chris Fields | 1 Sep 19:49
Favicon
Gravatar

Re: Bio::Tools::dpAlign feature request

On pSW: I agree, I don't think it is worth maintaining it considering  
there are actively supported C/C++-based toolkits with similar  
functionality (SeqAn) and Petr's BioLib initiative will likely be a  
more maintainable effort.

chris

On Sep 1, 2008, at 2:42 AM, Jason Stajich wrote:

> Safe to ignore the tests.  Those that are failing aren't even test  
> for Bio::Align::dpAlign - but were written to test a bug that has  
> not been fixed in the EVD module if I remember correctly that is why  
> they are marked in a TODO block, but I can't tell if the Test.pm is  
> actually skipping these tests or not.
>
> I think we probably need to deprecate some of these modules as there  
> is no maintainer of Ewan's code in here.
>
> At a minimum we need to modularlize the tests for these modules into  
> separate t dir and fix the need for multiple Makefile.PL in here and  
> probably move to Build.PL
>
> -jason
> On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:
>
>>
>> Hi Alexie
>>
>> My understanding is that you can ignore these failures.
>>
(Continue reading)

Permalink | Reply | 0 comments |
headers
Laurent Manchon | 3 Sep 15:04
Picon
Favicon

parsing result of CAP3 (ACE file)

-- Hi,

Is somebody have a piece of code to parse result of CAP3 assembly program which
format is ACE ?
I need to retrieve the alignment from this file.

thank you,
Laurent --

+---------------------------------------------+
  Laurent Manchon
  Email: lmanchon <at> univ-montp2.fr
+---------------------------------------------+
Permalink | Reply | 1 comment |
headers
John Osborne | 3 Sep 16:33
Picon

interpro parsing enhancement?

Hi -
I'm wondering if anyone is working on adding functionality to
Bio::SeqIO::interpro to grab the Gene Ontology/GO classifications out
of the interpro xml output?

I've started working on that myself, but wanted to check if anyone
else is doing the same.

Thanks!
--

-- 
John Osborne
osborne6 <at> ieee.org/osborne6 <at> gmail.com/jro <at> freeshell.org
Permalink | Reply | 0 comments |
headers
Gundala Viswanath | 3 Sep 16:48
Picon

Fitch's Parsimony Algorithm with Perl

Hi,

What's a correct way to implement Fitch's parsimony algorithm?
Especially to compute minimum substitiution rate per column
in the aligned sequence.

Is there a Bioperl module to do it?

For example
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat
CGACGGAATATTCCCCTCCGTGC   human
CGACGGAAGACTCTCCTCCGTGC   chimp

00100000302011000000100   -> number of subst per site (max parsimony)

My code below doesn't seem to do the job.

__BEGIN__
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = ' (mouse,rat,(human,chimp))';

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp
(Continue reading)

Permalink | Reply | 0 comments |
headers
Raul Mendez Giraldez | 3 Sep 16:33
Picon
Picon

Re: SeqHound

Hi Chris,

I'm trying to set up and run bioperl Seqhound donwloaded from:

http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz

and I always get connection error messages. Do you know which version of
SeqHound should I use and how can I configure to make it work? I've
tried several possibilities for server1 at .shoundremrc as

[remote]
server1 = bond.unleashedinformatics.com
CGI = /cgi-bin/seqrem
port=8080

Also, I would like to get all the possible protein-protein interaction
for a set of protein sequences. Would this be possible using SeqHound?

Thanks,
Raúl

--

-- 
Raúl Méndez Giráldez, Ph.D.
Bioinformatics Unit
Centre for Molecular Biology "Severo Ochoa"
Universidad Autónoma de Madrid
C/ Nicolás Cabrera, 1
Cantoblanco 28049, Madrid
SPAIN
(Continue reading)

Permalink | Reply | 1 comment |
headers
Joshua Udall | 3 Sep 17:38
Picon

Re: parsing result of CAP3 (ACE file)

Laurent -

I have modified modules that will do it as I recently ran into problems with
the DB_FILE module in Assembly::IO.  In addition, the current version of
cap3 seems to put a contig length where a pad length is expected (based on
the Ace format description).  The modules I have will parse the ace file
contig-by-contig rather than having the entire assembly slurped into memory
(or a tied hash) all at once.  You are welcome to them if you are interested
and I'd like to get them in Bioperl at some point.  Bascially, there are
three files - a modified Contig.pm, ContigIO.pm, and a modified ace.pm (in a
ContigIO directory).

Josh

On Wed, Sep 3, 2008 at 7:04 AM, Laurent Manchon <lmanchon <at> univ-montp2.fr>wrote:

> -- Hi,
>
> Is somebody have a piece of code to parse result of CAP3 assembly program
> which
> format is ACE ?
> I need to retrieve the alignment from this file.
>
> thank you,
> Laurent --
>
>
>
>
> +---------------------------------------------+
(Continue reading)

Permalink | Reply | 0 comments |
headers
George Hartzell | 4 Sep 01:19
Gravatar

What's up with line 248 of Bio::Coordinate::Pair?


Ok, confess.  None of you know what's up with line 248 of
Bio::Coordinate::Pair, do you?  You probably don't even know what's
*on* that line.  Wonder how many will go look.

Now that I either have your attention or have pissed you off (or
both...), I think that creating a new Bio::Location::Split object in
Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
quite sure enough to excise it and commit the change.

Anyone up for it?

g.
Permalink | Reply | 4 comments |
headers
Chris Fields | 4 Sep 03:29
Favicon
Gravatar

Re: What's up with line 248 of Bio::Coordinate::Pair?

Well, it doesn't look like the SplitLocation is even used, so I think  
it is safe to remove.

chris

On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:

>
> Ok, confess.  None of you know what's up with line 248 of
> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> *on* that line.  Wonder how many will go look.
>
> Now that I either have your attention or have pissed you off (or
> both...), I think that creating a new Bio::Location::Split object in
> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> quite sure enough to excise it and commit the change.
>
> Anyone up for it?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l <at> lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign
(Continue reading)

Permalink | Reply | 3 comments |
headers
Jason Stajich | 4 Sep 06:40
Gravatar

Re: What's up with line 248 of Bio::Coordinate::Pair?

Agreed - I don't know if that was something was changed mid-stream,  
but removing it should cause no pain...
-j
On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:

> Well, it doesn't look like the SplitLocation is even used, so I  
> think it is safe to remove.
>
> chris
>
> On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
>
>>
>> Ok, confess.  None of you know what's up with line 248 of
>> Bio::Coordinate::Pair, do you?  You probably don't even know what's
>> *on* that line.  Wonder how many will go look.
>>
>> Now that I either have your attention or have pissed you off (or
>> both...), I think that creating a new Bio::Location::Split object in
>> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
>> quite sure enough to excise it and commit the change.
>>
>> Anyone up for it?
>>
>> g.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l <at> lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
(Continue reading)

Permalink | Reply | 2 comments |

Gmane