Ashton Trey Belew | 31 Jul 05:25 2014
Picon

Bio::SearchIO::infernal.pm


  Good evening,
  I was fiddling with cmsearch this evening and discovered that the
current infernal parser does not play well with the new version (1.1)
of infernal.  I am currently hacking on the function parse_latest() in
an attempt to handle the differences in formats but have hit a bit of
a wall in picking up the accessions and descriptions from the cmsearch
output.
  In a peculiar turn of events, if parse_latest does not find the
accession/description fields, it seems to repeat the PARSER: loop
indefinitely, in my case repeating $self->_readline on the the 10th hit.

  I will keep poking at it this evening, but if anyone has made
greater headway, I would love some pointers.

  Thank you for your time,
 -Trey
Francesco Strozzi | 30 Jul 10:46 2014
Picon

EU OBF Codefest - September 18th and 19th 2014 <at> EBI - Hinxton UK

Dear all,
apologies if you receive this multiple times.

We are glad to announce that we are organising the European edition of
the OBF Codefest, which will take place on September 18th and 19th at
the EBI in Hinxton, UK. This is the second OBF Codefest this year, the
first was held this month in Boston just before the BOSC and ISMB
conferences and in September we will have the chance to expand and
carry on the work and discussions started in July in the USA.

The EU Codefest will precede the Genome
Informatics Conference in Cambridge, so we hope that developers
attending the main conference will be also interested in joining us
for a couple of days of coding and discussions on collaborative
projects and new ideas. The main topics that were proposed so far are:

* The OpenBio projects development (BioPerl, BioPython, BioRuby, BioJava)
* Semantic web technologies for biological data (e.g. RDF, OWL)
* Software deployment and bioinformatics pipelines, including
CloudBiolinux, Docker and GNU GUIX
* NoSQL databases and NGS data mining
* Biological data visualisation with e.g. D3/JS and BioJS.

We of course invite attendees to add other topics of interest.

For more information, you can visit the OBF Wiki page, which includes
also information on accommodation and registration:
http://www.open-bio.org/wiki/EU-Codefest_2014
If you plan to attend, please use the link in the registration section
and complete the simple steps on the EBI website, so that
(Continue reading)

Francisco J. Ossandón | 25 Jul 21:00 2014
Picon

"->bits" behaviour in HMMer parsing

Hello everyone,

I was checking Bio::SearchIO and found that there is an inconsistency regarding Bits value for $hit and $hsp when parsing HMMer outputs.

 

HMMer results don’t use Bits, so when Bits are requested from $hit, it returns 0 from the HMMERHit module (“sub bits { return 0 }”), but when Bits are requested from $hps, it goes to the SimilarityPair and Similarity modules and they return ‘undef’. Since $hit->bits already return 0, I think it would be consistent to also return 0 from $hsp->bits… Adding “sub bits { return 0 }” to the HMMERHSP module would do the trick.

 

What do you think?? Is it ok for me to add this to HMMERHSP and make it consistent or there could be something wrong with it??

 

Cheers,

 

Francisco

 

_______________________________________________
Bioperl-l mailing list
Bioperl-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/bioperl-l
Fields, Christopher J | 24 Jul 20:14 2014

Re: length of hit->description

That is unusual.  The only recourse is to submit a bug report to Github and attach an example report giving the
error.  My feeling is that this might be a change in the output for FASTA.

chris

On Jul 24, 2014, at 12:54 PM, Antony Vincent <antony.vincent.1 <at> ulaval.ca> wrote:

> Hello,
> 
> Thank you for the quick answer.
> 
> Here is a part of the code:
> #fasta parameters
> my $fh;  
> my $query = 'MyORF.tfa';
> my $library = "$library";                 
> my $fasta   = 'fasta35'; 
> 
> 
> # The fasta parsing part
> my $command = "$fasta -b 1 $query $library";
> 
> open $fh,"$command |" || die("cannot run fasta cmd of $command: $!\n");
> 
> my $searchio  = Bio::SearchIO->new(-format => 'fasta', -fh => $fh);
> while( my $result = $searchio->next_result ) {
>  ## $result is a Bio::Search::Result::ResultI compliant object
>  while( my $hit = $result->next_hit ) {
>    ## $hit is a Bio::Search::Hit::HitI compliant object
>    while( my $hsp = $hit->next_hsp ) {
>      ## $hsp is a Bio::Search::HSP::HSPI compliant object
>      if( $hsp->length('total') > $length*0.85) {
>        if ( $hsp->frac_conserved >= 0.65) {
> 
> 	
> 	print $hit->description(500), "\n";
> 	
> 
> 
> 				}
>            }
> 		}
> 	}  
> }
> 
> The correct result should be :
> repB	putative plasmid replication protein RepB
> 
> And I get:
> repB	putative plasmid replication protein R
> 
> Thank you,
> 
> Antony
> 
> Le 2014-07-24 à 13:48, Fields, Christopher J <cjfields <at> illinois.edu> a écrit :
> 
>> You’ll have to be more explicit.  What is the analysis (BLAST, FASTA, BLAT, etc)?  What is the expected
result?  
>> 
>> Most of the above parsers will take the hit name as the first set of non-whitespace characters, and
anything after that is put into the description.
>> 
>> chris
>> 
>> On Jul 24, 2014, at 12:04 PM, Antony03 <antony.vincent.1 <at> ulaval.ca> wrote:
>> 
>>> Hello,
>>> 
>>> When I use hit->description I get a truncated result like this:
>>> 
>>> repB putative plasmid replication protein R
>>> 
>>> I tried hit->description(500) and I get the same result.
>>> 
>>> Is there something wrong?
>>> 
>>> Thanks
>>> 
>>> 
>>> 
>>> --
>>> View this message in context: http://bioperl.996286.n3.nabble.com/length-of-hit-description-tp17596.html
>>> Sent from the Bioperl-L mailing list archive at Nabble.com.
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l <at> mailman.open-bio.org
>>> http://mailman.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
Antony03 | 24 Jul 19:04 2014
Picon

length of hit->description

Hello,

When I use hit->description I get a truncated result like this:

repB putative plasmid replication protein R

I tried hit->description(500) and I get the same result.

Is there something wrong?

Thanks

--
View this message in context: http://bioperl.996286.n3.nabble.com/length-of-hit-description-tp17596.html
Sent from the Bioperl-L mailing list archive at Nabble.com.
Mark A. Jensen | 24 Jul 04:34 2014
Picon

Would like to recover my wiki acct pls

Can someone help me connect my OpenId to my existing wiki acct? I could 
probably do it myself, but---hey, I can't log in!
Instructions to do so at http://www.bioperl.org/wiki/OpenID are no 
longer valid.
Thanks very much-
MAJ
Fields, Christopher J | 24 Jul 00:28 2014

[Announcement] Moving to GitHub Issues!

I’m not sure it has been officially announced, so apologies if this is a repeat post.

We are moving all future bug reports and feature requests to Github.  At the moment we will keep the current
redmine instance with the original bug reports but we consider it read-only; issues will possibly be
migrated over time. 

We have made changes documenting this on the main BioPerl wiki and to the relevant code.  Let us know if you
have any questions or concerns.

chris
Darío Carballido | 21 Jul 17:57 2014
Picon

Problem with StandAloneBlastPlus

Hello,

 

I’m working with this script that uses StandAloneBlastPlus, and I would like to take advantage of a new feature in the latest releases of blast+, which allows me to present the query coverage in the output (among other values). For that to work, the value of –outfmt needs to be quoted (for example, -outfmt “7 std qcovs”), so I’m passing the outfmt parameter via

 

-method_args => [ '-outfmt' => '"7 std qcovs"' ]

 

(I’m using single quotes with doubles inside, so that the double quotes are passed literally).

 

But when I run it, the quotes seem to get lost and I end up with the error I get when I pass that value without the quotes:

 

Error: Too many positional arguments (1), the offending value: std  

 

I have tried lots of combinations with single, double quotes, character escaping and I couldn’t find the way to make it work.  

 

Any help?

 

Thanks,

Darío Carballido

_______________________________________________
Bioperl-l mailing list
Bioperl-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/bioperl-l
Antony03 | 18 Jul 02:14 2014
Picon

Problem with revcom

Hello,

I try to reverse complement a sequence found with fasta36:

	if ( $hsp->strand('query') == -1 ) {
my $rev_output=$hsp->hit_string->revcom();
print "$rev_output";
          }

And I get an error like:

Can't locate object method "revcom" via package 

Can someone know what is wrong with my code?

Thanks,

Antony

--
View this message in context: http://bioperl.996286.n3.nabble.com/Problem-with-revcom-tp17581.html
Sent from the Bioperl-L mailing list archive at Nabble.com.
George Hartzell | 17 Jul 19:23 2014

Whither Bio::FeatureIO?

I'm following instructions on the GMOD site to install the Chado schema and related tools.

I used cpanm to install BioPerl, which gives me the current version.

Various Chado-related tools, e.g. load/bin/gmod_bulk_load_gff3, require Bio::FeatureIO, which is no
longer in the BioPerl distribution.

I've found a GitHub repo for it, but I can't find any sign of it on CPAN.

Has it ever been released?

Thanks.

g.

Sent from a device that makes me type with two fingers.
Haiyan Lin | 14 Jul 15:23 2014
Picon

回复: Re: use Bio::SeqIO to read Fasta sequence from pipe, or <at> ARGV, like "while (<>) {....}"

Hi,paul,

That is what I want. Thank you for you advice and kind reminding on how to 
ask for help. I will remember. Thanks and wishes to all again.


Haiyan 




从三星手机发送



-------- 原始邮件 --------
发件人: Paul Cantalupo <pcantalupo <at> gmail.com>
日期: 2014-07-14 PM 8:50 (GMT+08:00)
收件人: Haiyan Lin <linhy0120 <at> gmail.com>
抄送: Bioperl-l <at> mailman.open-bio.org
主题: Re: [Bioperl-l] use Bio::SeqIO to read Fasta sequence from pipe, or <at> ARGV, like "while (<>) {....}"


Hi Haiyan,

Ah your specifications are now clearer! I use the '-p' file test to check if STDIN is a named pipe (http://perldoc.perl.org/functions/-X.html) to do the same thing that you are trying to do:

use strict;
use warnings;
use Bio::SeqIO;
my $in;
if (-p STDIN) {
  $in = Bio::SeqIO->new(-fh => \*STDIN, -format => 'fasta');
}
else {
  $in = Bio::SeqIO->new(-file => shift);
}
while (my $seq = $in->next_seq) {
  print $seq->length,"\n";
}


Here is my input file and results when running both ways:

$ cat foo.fa
>foo1
tgtagtc
>foo2
taaaacgtgtcat

$ cat foo.fa | both.pl
7
13

$ both.pl foo.fa
7
13


Hope this helps,

Paul


P.S. Next time you ask a question, your reply to Chris Fields is exactly how you should ask a question. It will enable us to better help you   ;)






Paul Cantalupo
University of Pittsburgh


On Mon, Jul 14, 2014 at 1:26 AM, Haiyan Lin <linhy0120 <at> gmail.com> wrote:
Thanks all reply and advice first.

I want to handle a single can handle data provided in two ways:

1)Read data from a file, such as "perl fastaLen.pl try.fa". No problem
for "-fh=>$filename".

2)Read data from output of cmmand, such as "less try.fa | perl
fastaLen.pl". No probelm when using "-fh=>\*STDIN".


And, I can do this by first read data through <>, and write into a tmp
file, and
creat instance of Bio::SeqIO with "-fh=>\$tmpFile", then remove the tmp
file.  I'm looking for a way to avoiding writing/removing tmp file.

Thanks.

Haiyan






On Sun, 2014-07-13 at 15:12 +0000, Fields, Christopher J wrote:
> Haiyan,
>
> Do you want a test script that uses the DATA handle or a script that can pull in data from STDIN (e.g. from outside)?  They are not the same.  It’s possible to do both but I think you’re conflating purposes here; someone using this script might not expect it to behave both ways.
>
> chris
>
> On Jul 12, 2014, at 9:23 PM, Haiyan Lin <linhy0120 <at> gmail.com> wrote:
>
> > Hi, geogre,
> >
> > Thanks your code is working for data embedded in code with "__DATA__".
> > But, it failed to hand data from outside. Following is the data and
> > result.
> >
> > [linhy <at> bioinfo1 Script]$ more try.fa
> >> Contig000001
> > CCACGTAAGAGCACCTGGGTCCCCGCCCGCCAAGCGCCGCGAGCGCCAGCAGCAGCTCGC
> >> hello
> > ATATATTTTT
> > [linhy <at> bioinfo1 Script]$ cat try.fa | perl try.pl
> > seq is AGAGAGAGA
> > seq is ATATATAT
> >
> > Thanks
> >
> > Haiyan
> >
> >
> >
> > On Sat, 2014-07-12 at 18:36 -0700, george hartzell wrote:
> >> I just did this on my Mac OS X 10.9.4 system with perl 5.18.2:
> >>
> >> cd tmp
> >> mkdir haiyan
> >> cd haiyan
> >> cpanm -n -L local Bio::SeqIO
> >>
> >> perl -Ilocal/lib/perl5 foo.pl
> >>
> >> With the following little program in foo.pl:
> >>
> >> use Bio::SeqIO ;
> >>
> >> my $in = Bio::SeqIO->new(-format=>"Fasta", -fh => \*DATA);
> >> while(my $s = $in->next_seq()){
> >>    print "seq is " . $s->seq . "\n"
> >> }
> >>
> >> __DATA__
> >>> ct1
> >> AGAGAGAGA
> >>> ctg2
> >> ATATATAT
> >>
> >> and it does this when I run it:
> >>
> >> (alacrity)[18:22:58]haiyan>>perl -Ilocal/lib/perl5 foo.pl
> >> seq is AGAGAGAGA
> >> seq is ATATATAT
> >> (alacrity)[18:24:42]haiyan>>
> >>
> >> Can you get the same series of things to work?
> >>
> >> If you’re doing a bunch of this kind of stuff, you might want to look
> >> at Data::Section; rjbs discusses it
> >> here. It’s warmer and fuzzier than dealing with the DATA handle by
> >> yourself.
> >>
> >> g.
> >>
> >> ​
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l <at> mailman.open-bio.org
> > http://mailman.open-bio.org/mailman/listinfo/bioperl-l
>



_______________________________________________
Bioperl-l mailing list
Bioperl-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/bioperl-l

Gmane