Warren Gallin | 16 Apr 07:37 2014
Picon
Picon

Possible Repeat E-Mail

Jason,

	My previous message bounced, presumably because I included an attachment.

	On the chance that it did not make it through, here is the relevant test case:

A script called Test_Script.pl is as follows:

____________________________________________________________________

#!/usr/bin/perl 

use strict;
use warnings;
use DBI;
use Bio::Seq;
use Bio::DB::EUtilities;
use Bio::SeqIO;
use Bio::Seq;
use Data::Printer;
use Bio::DB::GenBank;

my $gi = 302393575;  #This gi number is for the protein record of a horse ion channel
my $spliced_cds;
my $na_seq;
my %na_vkcnt_id;

#Create a database handle to GENBANK for retrieving coding sequences

my $gb_db = Bio::DB::GenBank->new();
(Continue reading)

Warren Gallin | 15 Apr 20:39 2014
Picon
Picon

Getting coding sequence starting with a protein record

I am having a problem finding a general method of recovering the nucleotide coding sequence for a protein
sequence record.

Generally tracking the CDS annotation back to the nucleotide sequence record using the accession number
of the nucleotide sequence is working.

One problem arises when the underlying coding sequence is spliced from multiple nucleotide records.  Is
there a general approach to automatically track down and joint the different sequence fragments from
different sequence entries?  An example of the problem can be seen if you start from the protein record with
GI number 7715882.  It is annotated as coming from three different nucleotide records.  Is there an
approach in Bioperl that will detect and download these three records and splice together the
appropriate parts to get the coding sequence?

The other problem that I am having is the ongoing issue of protein records annotated as highly redundant
sequences , with WP-XXXXXX accession numbers.  Has anyone found a way to retrieve the set of different
nucleotide sequences that all encode a single AP-annotated protein sequence?

Any help would be appreciated,

Warren Gallin
Yoshiro Nagao | 14 Apr 08:06 2014
Picon

about Open-Source Genomic Analysis

Dear all,

I came across the following article

N Engl J Med. 2011 Aug 25;365(8):718-24.
Open-source genomic analysis of Shiga-toxin-producing E. coli O104:H4.

in which the authors requested bioinformatical analyses worldwide 
(crowd-sourcing).

The detail is available from:
https://github.com/ehec-outbreak-crowdsourced/BGI-data-analysis/wiki

I am interested in this way of outsourcing bioinformatical analysis, which
may find bioinformatician(s) that are most appropriate for a specific problem.

How could such a request of outsourced bioinformatical analysis be made,
and to what extent? 
Are there any ethical consideration? 

Any information would be appreciated,

Yoshiro Nagao
Warren Gallin | 31 Mar 21:48 2014
Picon
Picon

Eutilities not responding

Hi,

	My scripts, which were working last night are now failing with a time-out message as follows:

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Response Error
Status read failed: Operation timed out
STACK: Error::throw
STACK: Bio::Root::Root::throw /opt/local/lib/perl5/site_perl/5.12.3//Bio/Root/Root.pm:472
STACK: Bio::DB::GenericWebAgent::get_Response /opt/local/lib/perl5/site_perl/5.12.3//Bio/DB/GenericWebAgent.pm:214
STACK: Bio::DB::EUtilities::get_Response /opt/local/lib/perl5/site_perl/5.12.3//Bio/DB/EUtilities.pm:262
STACK: Bio::DB::EUtilities::get_Parser /opt/local/lib/perl5/site_perl/5.12.3//Bio/DB/EUtilities.pm:345
STACK: Bio::DB::EUtilities::next_History /opt/local/lib/perl5/site_perl/5.12.3//Bio/DB/EUtilities.pm:658
STACK: NCBI_Retrival::eutilities_getdata NCBI_Retrival.pm:76
STACK: Main_Check_Create.pl:135
—————————————————————————————

When I try to ping eutils.wip.ncbi.nlm.nih.gov all the packets are lost, no returns whatsoever.

Can anyone else reproduce this?  I can not tell if it is something local with me or something happening on the
NCBI side of things.

Thanks,

Warren Gallin
dayong guo | 31 Mar 19:34 2014
Picon

online cas9 design tool

Dear All,

COD (Cas9 & Off-target Designer) http://cas9.wicp.net/ is a perl 
constructed online tool to design Cas9 RNA directed DNA nuclease. I made it 
as a spare time hobby. Please try it if you need, and let me know your 
suggestions.

Thanks a lot for the bioperl google group!

Day
Dave Messina | 29 Mar 03:00 2014

Fwd: edit to PAML.pm

Hi Volker,

Your revert does work for yn00 output, but unfortunately breaks the code
for another type of output (see Bug 3332,
https://redmine.open-bio.org/issues/3332), one of many horrendous format
issues PAML brings.

I've committed a fix (12ddb53) that does special case parsing for yn00. I
haven't tested it extensively, so please don't hesitate to try it out and
submit an improved version via pull request at github if need be.

Best,
Dave

On Thu, Mar 27, 2014 at 6:01 PM, Jason Stajich <jason <at> bioperl.org> wrote:

> Hi - great to hear that it is still useful - I have long stopped having
> time to try and track the versions of PAML and the output changes so that
> our parser will work better.
>
>  I am CC-ing Dave Messina who was the last person to touch this module I
> believe as he may be able to take a look at it and contribute - this looks
> extra simple so it may be easy enough for Dave or someone else to do this
> fix.
>
>  I would encourage you to contribute fixes directly in the future if you
> can at the github repository -- esp if you are using the module and are
> undoubtable hitting some issues with the format.
>
> Thanks,
(Continue reading)

Francisco J. Ossandón | 28 Mar 04:53 2014
Picon

Re: New to BioPerl ... part II

Hi Olivier,
After the last release of BioPerl, I started to work to resolve all those
issues that only appear in Windows (the inplace edit in Bio::Root::IO, the
"cannot unlink file" errors, the use of 'cat' linux comand), and now all
tests pass in my Windows system (if there is any error in the latest code
let me know). Those fixes will be present in the next release of BioPerl,
BUT you can download the current developer version before the next official
release, if you go to the GitHub repository corresponding branch
(https://github.com/bioperl/bioperl-live/tree/v1.6.x) and press the Download
ZIP button. By the way, you can safely ignore some messages that are
warnings and not errors (the BioDBGFF.t  message and the "subroutine xxxx
redefined" messages).

For BioPerl-DB, the last release was 3 years ago and I have not checked it
in Windows yet, so it could have unresolved bugs. My recent experience have
shown me that the difference in the characters used as line-ending between
linux (1 char) and windows (2 chars), is a common source of bugs. =/

Cheers,

Francisco J. Ossandon
vinu manikandan | 27 Mar 08:28 2014
Picon

gbkparser needs more info

Dear Team,

I m trying to parse GBK file using bio perl  attached here is the code im
using to extract the dna and ptn sequence from the file including that i
also need to extract other informations such as organism name and DBLink id

Please let me know how to do the same

--

-- 
M.Vinu
Attachment (gbkparser.pl.rtf): application/rtf, 2009 bytes
_______________________________________________
Bioperl-l mailing list
Bioperl-l <at> lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l
Karsten | 26 Mar 16:54 2014
Picon

Bio-Samtools-1.39 and Samtools-0.2.0

I am having trouble compiling Bio-Samtools-1.39
with Samtools-0.2.0. I searched the archives and it
seems like updates were previously needed to fix 
this issue. Any advice how to get it to compile?

I receive the following error with compiling:
error building c_bin/bam2bedgraph.o from 'c_bin/bam2bedgraph.c'

I tried modifying the samtools makefile with -fPIC 
but that doesn't seem to help. 

Any suggestions?

Thanks!
Karsten
Hannes Hettling | 27 Mar 13:03 2014
Picon

DNAStatistics distance between non-overlapping sequences

A few years ago, a bug was reported (bug 2901) and apparently fixed
(http://bioperl.org/pipermail/bioperl-l/2010-January/032026.html) in
DNAStatistics when calculating distances of non overlapping sequences. 

However, I am still getting the error

'Illegal division by zero
at /usr/local/src/bioperl-live/Bio/Align/DNAStatistics.pm line 527'

when calculating distances for the following sequences:

>seq1
GGTACCAGCAGGTGGGCCGCCTACTGCGCACGCGCGGGTTTGCGGGCAGCCGC
>seq2
GGTACCAGCTGGTGGGCCGCCTACTGCGCACGCGCGGGTTTGCGGGCAGCCGC
>seq3
GGTACCAGCAGGTGGTCCGCCTA------------------------------
>seq4
--------------------------CGCACGCGCGTGTTTGCGGGCAGCCGC

I am using the latest bioperl-live from github.
Could anyone suggest a way around this?

Many thanks in advance,

Hannes
Smithies, Russell | 26 Mar 19:19 2014
Picon

(OT) Come work in New Zealand - Job: Senior Bioinformatician at AgResearch

Hi everyone,

I would like to bring the following position to your notice.  I would also appreciate if this could please be
circulated to your wider network.

Thanx,

--Russell

-----------------------------------------------------

Senior Bioinformatician

AgResearch Ltd. New Zealand

AgResearch is a Crown Research Institute with the purpose of enhancing the value, productivity and
profitability of New Zealand's agricultural sector.  The Bioinformatics team supports scientific
research in a range of areas to the benefit of the pastoral agricultural sector.

We are seeking a highly motivated individual with excellent training and expertise in Bioinformatics to
join our team.  The successful candidate will be responsible for providing Bioinformatics consultancy
to a range of science projects.  Main duties will involve analysing high throughput/high-dimensional
'omics data from mostly non-model organisms, this includes the design, development, implementation
and testing of bioinformatics pipelines for Next-Gen Sequencing (NGS) data, assembly and expression
analysis of NGS data and contribution towards interpreting the results.  Experience in working with
Genotyping by Sequencing data would be advantageous. The ideal candidate will also have some experience
or an interest in integrating multi-faceted 'omics data to understand underlying systems a
 nd biological networks.  This is a senior and permanent position.

The successful applicant will have a PhD or high level postgraduate qualification in Bioinformatics (or
(Continue reading)


Gmane