Jose Manuel Duarte | 20 Jan 10:23 2015
Picon

Biojava 4 release

For anyone not following the github issues, we've had an agreement that 
the Biojava 4 release will happen in about 2 weeks with a code-freeze 
declared for the 29th of January. So please submit any uncommitted 
patches before that time. If the modules and/or packages are renamed, 
merging will become much more complicated after that.

Follow the release process here: 
https://github.com/biojava/biojava/issues/238

Jose

_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Dave Roe | 20 Dec 22:41 2014
Picon

create Profile from a file in biojava3

I can't figure out how to create a Profile object from a MSA file (e.g., .msf) in biojava3. Any suggestions?
--
Dave
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l
Rose, Peter | 5 Dec 19:28 2014

[Job] Senior Scientist and Senior Java Web Developer positions at RCSB PDB/UCSD

The RCSB PDB at UC San Diego seeks candidates with a track record of
achievement in Structural and Computational Biology combined with strong
Scientific Software Development expertise.

 
For details and direction
to apply please follow this link:
http://www.rcsb.org/pdb/static.do?p=general_information/about_pdb/contact/j
ob_listings.html

 
For more information about UCSD, please visit http://www.ucsd.edu/. As
part of the University of California, we offer a generous benefits package
plus many educational opportunities.

 
Please contact Dr. Peter Rose at pwrose <at> ucsd.edu for more information
about the positions.

 

Peter Rose, Ph.D.
Scientific Lead, RCSB Protein Data Bank (http://www.rcsb.org)
San Diego Supercomputer Center
University of California, San Diego

_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Dropbox | 26 Nov 23:53 2014

Shashank Gupta invited you to check out Dropbox

Hi there,

Shashank Gupta wants you to try Dropbox! Dropbox lets you bring all your photos, docs, and videos with you anywhere and share them easily.

Accept invite
Thanks!
- The Dropbox Team
If you prefer not to receive invites from Dropbox, please go here.
Dropbox, Inc., PO Box 77767, San Francisco, CA 94107
© 2014 Dropbox
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l
Khalil El Mazouari | 17 Nov 13:17 2014
Picon

Re: Biojava-l Digest, Vol 141, Issue 11

Hi,

Fixed. parallelStream from lambda was calling non synchronized method. 

Best

On 17 Nov 2014, at 13:00, biojava-l-request <at> mailman.open-bio.org wrote:

> Send Biojava-l mailing list submissions to
> 	biojava-l <at> mailman.open-bio.org
> 
> To subscribe or unsubscribe via the World Wide Web, visit
> 	http://mailman.open-bio.org/mailman/listinfo/biojava-l
> or, via email, send a message with subject or body 'help' to
> 	biojava-l-request <at> mailman.open-bio.org
> 
> You can reach the person managing the list at
> 	biojava-l-owner <at> mailman.open-bio.org
> 
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of Biojava-l digest..."
> 
> 
> Today's Topics:
> 
>   1. java 8 - Term cannot be null (Khalil El Mazouari)
> 
> 
> ----------------------------------------------------------------------
> 
> Message: 1
> Date: Sun, 16 Nov 2014 15:03:30 +0100
> From: Khalil El Mazouari <khalil.elmazouari <at> gmail.com>
> To: biojava-l <at> mailman.open-bio.org
> Subject: [Biojava-l] java 8 - Term cannot be null
> Message-ID: <C9286623-43D5-4230-AC37-50C79BFF989F <at> gmail.com>
> Content-Type: text/plain; charset=windows-1252
> 
> Hi,
> 
> I am porting my java/BioJava project to BioJava 1.9.1/java 8, in order to use lambda expressions.
> 
> IllegalArgumentException: Term cannot be null exception is sometimes raised. Can?t trace it back as
it?s not raised at every run. It seems to be Thread-Related? and it?s not raised if I use BioJava 1.8.2/Java
7. 
> 
> Best
> 
> 
> Exception in thread "main" java.lang.IllegalArgumentException: Term cannot be null
> 	at org.biojavax.bio.seq.SimpleRichFeature.setTypeTerm(SimpleRichFeature.java:330)
> 	at org.biojavax.bio.seq.SimpleRichFeature.setType(SimpleRichFeature.java:315)
> 	?.
> 	at com.kem.ae.core.AnnotationManager.lambda$annotate$5(AnnotationManager.java:122)
> 	at com.kem.ae.core.AnnotationManager$$Lambda$1/10347942.accept(Unknown Source)
> 	at java.util.stream.ForEachOps$ForEachOp$OfRef.accept(ForEachOps.java:183)
> 	at java.util.ArrayList$ArrayListSpliterator.forEachRemaining(ArrayList.java:1374)
> 	at java.util.stream.AbstractPipeline.copyInto(AbstractPipeline.java:512)
> 	at java.util.stream.ForEachOps$ForEachTask.compute(ForEachOps.java:290)
> 	at java.util.concurrent.CountedCompleter.exec(CountedCompleter.java:731)
> 	at java.util.concurrent.ForkJoinTask.doExec(ForkJoinTask.java:289)
> 	at java.util.concurrent.ForkJoinPool$WorkQueue.runTask(ForkJoinPool.java:902)
> 	at java.util.concurrent.ForkJoinPool.scan(ForkJoinPool.java:1689)
> 	at java.util.concurrent.ForkJoinPool.runWorker(ForkJoinPool.java:1644)
> 	at java.util.concurrent.ForkJoinWorkerThread.run(ForkJoinWorkerThread.java:157)
> 
> 
> ------------------------------
> 
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biojava-l
> 
> End of Biojava-l Digest, Vol 141, Issue 11
> ******************************************

_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Khalil El Mazouari | 16 Nov 15:03 2014
Picon

java 8 - Term cannot be null

Hi,

I am porting my java/BioJava project to BioJava 1.9.1/java 8, in order to use lambda expressions.

IllegalArgumentException: Term cannot be null exception is sometimes raised. Can’t trace it back as
it’s not raised at every run. It seems to be Thread-Related… and it’s not raised if I use BioJava
1.8.2/Java 7. 

Best

Exception in thread "main" java.lang.IllegalArgumentException: Term cannot be null
	at org.biojavax.bio.seq.SimpleRichFeature.setTypeTerm(SimpleRichFeature.java:330)
	at org.biojavax.bio.seq.SimpleRichFeature.setType(SimpleRichFeature.java:315)
	….
	at com.kem.ae.core.AnnotationManager.lambda$annotate$5(AnnotationManager.java:122)
	at com.kem.ae.core.AnnotationManager$$Lambda$1/10347942.accept(Unknown Source)
	at java.util.stream.ForEachOps$ForEachOp$OfRef.accept(ForEachOps.java:183)
	at java.util.ArrayList$ArrayListSpliterator.forEachRemaining(ArrayList.java:1374)
	at java.util.stream.AbstractPipeline.copyInto(AbstractPipeline.java:512)
	at java.util.stream.ForEachOps$ForEachTask.compute(ForEachOps.java:290)
	at java.util.concurrent.CountedCompleter.exec(CountedCompleter.java:731)
	at java.util.concurrent.ForkJoinTask.doExec(ForkJoinTask.java:289)
	at java.util.concurrent.ForkJoinPool$WorkQueue.runTask(ForkJoinPool.java:902)
	at java.util.concurrent.ForkJoinPool.scan(ForkJoinPool.java:1689)
	at java.util.concurrent.ForkJoinPool.runWorker(ForkJoinPool.java:1644)
	at java.util.concurrent.ForkJoinWorkerThread.run(ForkJoinWorkerThread.java:157)
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Khalil El Mazouari | 8 Nov 18:30 2014
Picon

Re: Biojava-l Digest, Vol 141, Issue 8

Hi,

I agree ;) It's fixed on 4.0.0-SNAPSHOT.

Any idea when biojava 4 will be released?

Thanks

kem

On 08 Nov 2014, at 13:00, biojava-l-request <at> mailman.open-bio.org wrote:

> Send Biojava-l mailing list submissions to
> 	biojava-l <at> mailman.open-bio.org
> 
> To subscribe or unsubscribe via the World Wide Web, visit
> 	http://mailman.open-bio.org/mailman/listinfo/biojava-l
> or, via email, send a message with subject or body 'help' to
> 	biojava-l-request <at> mailman.open-bio.org
> 
> You can reach the person managing the list at
> 	biojava-l-owner <at> mailman.open-bio.org
> 
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of Biojava-l digest..."
> 
> 
> Today's Topics:
> 
>   1. java 8 - Biojava3	java.util.concurrent.ExecutionException:
>      java.lang.ExceptionInInitializerError (Khalil El Mazouari)
>   2. Re: java 8 - Biojava3
>      java.util.concurrent.ExecutionException:
>      java.lang.ExceptionInInitializerError (Jose Manuel Duarte)
> 
> 
> ----------------------------------------------------------------------
> 
> Message: 1
> Date: Fri, 7 Nov 2014 21:56:18 +0100
> From: Khalil El Mazouari <khalil.elmazouari <at> gmail.com>
> To: biojava-l <at> mailman.open-bio.org
> Subject: [Biojava-l] java 8 - Biojava3
> 	java.util.concurrent.ExecutionException:
> 	java.lang.ExceptionInInitializerError
> Message-ID: <BC1B67CE-A3EE-4734-870F-826BFEBBE93E <at> gmail.com>
> Content-Type: text/plain; charset=windows-1252
> 
> Hi
> 
> I am porting my code from java 7 to java 8.
> 
> Biojava3.alignment is not working on java 8! While it was OK on java 7
> 
> All jars are in the classpath. 
> 
> Thanks
> 
> Khalil
> 
> java.util.concurrent.ExecutionException: java.lang.ExceptionInInitializerError
> 	at java.util.concurrent.FutureTask.report(FutureTask.java:122)
> 	at java.util.concurrent.FutureTask.get(FutureTask.java:192)
> 	at org.biojava3.alignment.Alignments.getListFromFutures(Alignments.java:289)
> 	at org.biojava3.alignment.Alignments.runPairwiseScorers(Alignments.java:612)
> 	at org.biojava3.alignment.Alignments.getMultipleSequenceAlignment(Alignments.java:180)
> ...
> Caused by: java.lang.ExceptionInInitializerError
> 	at org.biojava3.alignment.SimpleAlignedSequence.setLocation(SimpleAlignedSequence.java:358)
> 	at org.biojava3.alignment.SimpleAlignedSequence.<init>(SimpleAlignedSequence.java:88)
> 	at org.biojava3.alignment.SimpleProfile.<init>(SimpleProfile.java:118)
> 	at org.biojava3.alignment.SimpleSequencePair.<init>(SimpleSequencePair.java:86)
> 	at org.biojava3.alignment.SimpleSequencePair.<init>(SimpleSequencePair.java:69)
> 	at org.biojava3.alignment.NeedlemanWunsch.setProfile(NeedlemanWunsch.java:71)
> 	at org.biojava3.alignment.template.AbstractMatrixAligner.align(AbstractMatrixAligner.java:342)
> 	at org.biojava3.alignment.template.AbstractPairwiseSequenceAligner.getPair(AbstractPairwiseSequenceAligner.java:112)
> 	at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112)
> 	at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105)
> 	at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53)
> 	at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38)
> 	at java.util.concurrent.FutureTask.run(FutureTask.java:266)
> 	at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)
> 	at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
> 	at java.lang.Thread.run(Thread.java:745)
> Caused by: java.lang.NullPointerException
> 	at java.util.Collections$UnmodifiableCollection.<init>(Collections.java:1026)
> 	at java.util.Collections$UnmodifiableList.<init>(Collections.java:1302)
> 	at java.util.Collections.unmodifiableList(Collections.java:1287)
> 	at org.biojava3.core.sequence.location.template.AbstractLocation.<init>(AbstractLocation.java:111)
> 	at org.biojava3.core.sequence.location.template.AbstractLocation.<init>(AbstractLocation.java:85)
> 	at org.biojava3.core.sequence.location.SimpleLocation.<init>(SimpleLocation.java:57)
> 	at org.biojava3.core.sequence.location.SimpleLocation.<init>(SimpleLocation.java:53)
> 	at org.biojava3.core.sequence.location.template.Location.<clinit>(Location.java:48)
> 	... 16 more
> java.util.concurrent.ExecutionException: java.lang.NoClassDefFoundError: Could not initialize
class org.biojava3.core.sequence.location.SimpleLocation
> 
> ?.
> 
> 
> ------------------------------
> 
> Message: 2
> Date: Fri, 07 Nov 2014 23:22:06 +0100
> From: Jose Manuel Duarte <jose.duarte <at> psi.ch>
> To: biojava-l <at> mailman.open-bio.org
> Subject: Re: [Biojava-l] java 8 - Biojava3
> 	java.util.concurrent.ExecutionException:
> 	java.lang.ExceptionInInitializerError
> Message-ID: <545D460E.1040508 <at> psi.ch>
> Content-Type: text/plain; charset=windows-1252; format=flowed
> 
> Are you using Biojava 3.1? This indeed seems to be a problem in 3.1 and 
> before.
> 
> However I've tried with the current 4.0.0-SNAPSHOT and it seems to work 
> fine.
> 
> Jose
> 
> 
> 
> On 07.11.2014 21:56, Khalil El Mazouari wrote:
>> Hi
>> 
>> I am porting my code from java 7 to java 8.
>> 
>> Biojava3.alignment is not working on java 8! While it was OK on java 7
>> 
>> All jars are in the classpath.
>> 
>> Thanks
>> 
>> Khalil
>> 
>> java.util.concurrent.ExecutionException: java.lang.ExceptionInInitializerError
>> 	at java.util.concurrent.FutureTask.report(FutureTask.java:122)
>> 	at java.util.concurrent.FutureTask.get(FutureTask.java:192)
>> 	at org.biojava3.alignment.Alignments.getListFromFutures(Alignments.java:289)
>> 	at org.biojava3.alignment.Alignments.runPairwiseScorers(Alignments.java:612)
>> 	at org.biojava3.alignment.Alignments.getMultipleSequenceAlignment(Alignments.java:180)
>> ...
>> Caused by: java.lang.ExceptionInInitializerError
>> 	at org.biojava3.alignment.SimpleAlignedSequence.setLocation(SimpleAlignedSequence.java:358)
>> 	at org.biojava3.alignment.SimpleAlignedSequence.<init>(SimpleAlignedSequence.java:88)
>> 	at org.biojava3.alignment.SimpleProfile.<init>(SimpleProfile.java:118)
>> 	at org.biojava3.alignment.SimpleSequencePair.<init>(SimpleSequencePair.java:86)
>> 	at org.biojava3.alignment.SimpleSequencePair.<init>(SimpleSequencePair.java:69)
>> 	at org.biojava3.alignment.NeedlemanWunsch.setProfile(NeedlemanWunsch.java:71)
>> 	at org.biojava3.alignment.template.AbstractMatrixAligner.align(AbstractMatrixAligner.java:342)
>> 	at org.biojava3.alignment.template.AbstractPairwiseSequenceAligner.getPair(AbstractPairwiseSequenceAligner.java:112)
>> 	at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112)
>> 	at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105)
>> 	at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53)
>> 	at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38)
>> 	at java.util.concurrent.FutureTask.run(FutureTask.java:266)
>> 	at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)
>> 	at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
>> 	at java.lang.Thread.run(Thread.java:745)
>> Caused by: java.lang.NullPointerException
>> 	at java.util.Collections$UnmodifiableCollection.<init>(Collections.java:1026)
>> 	at java.util.Collections$UnmodifiableList.<init>(Collections.java:1302)
>> 	at java.util.Collections.unmodifiableList(Collections.java:1287)
>> 	at org.biojava3.core.sequence.location.template.AbstractLocation.<init>(AbstractLocation.java:111)
>> 	at org.biojava3.core.sequence.location.template.AbstractLocation.<init>(AbstractLocation.java:85)
>> 	at org.biojava3.core.sequence.location.SimpleLocation.<init>(SimpleLocation.java:57)
>> 	at org.biojava3.core.sequence.location.SimpleLocation.<init>(SimpleLocation.java:53)
>> 	at org.biojava3.core.sequence.location.template.Location.<clinit>(Location.java:48)
>> 	... 16 more
>> java.util.concurrent.ExecutionException: java.lang.NoClassDefFoundError: Could not
initialize class org.biojava3.core.sequence.location.SimpleLocation
>> 
>> ?.
>> _______________________________________________
>> Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
>> http://mailman.open-bio.org/mailman/listinfo/biojava-l
> 
> 
> 
> ------------------------------
> 
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biojava-l
> 
> End of Biojava-l Digest, Vol 141, Issue 8
> *****************************************


_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Khalil El Mazouari | 7 Nov 21:56 2014
Picon

java 8 - Biojava3 java.util.concurrent.ExecutionException: java.lang.ExceptionInInitializerError

Hi

I am porting my code from java 7 to java 8.

Biojava3.alignment is not working on java 8! While it was OK on java 7

All jars are in the classpath. 

Thanks

Khalil

java.util.concurrent.ExecutionException: java.lang.ExceptionInInitializerError
	at java.util.concurrent.FutureTask.report(FutureTask.java:122)
	at java.util.concurrent.FutureTask.get(FutureTask.java:192)
	at org.biojava3.alignment.Alignments.getListFromFutures(Alignments.java:289)
	at org.biojava3.alignment.Alignments.runPairwiseScorers(Alignments.java:612)
	at org.biojava3.alignment.Alignments.getMultipleSequenceAlignment(Alignments.java:180)
...
Caused by: java.lang.ExceptionInInitializerError
	at org.biojava3.alignment.SimpleAlignedSequence.setLocation(SimpleAlignedSequence.java:358)
	at org.biojava3.alignment.SimpleAlignedSequence.<init>(SimpleAlignedSequence.java:88)
	at org.biojava3.alignment.SimpleProfile.<init>(SimpleProfile.java:118)
	at org.biojava3.alignment.SimpleSequencePair.<init>(SimpleSequencePair.java:86)
	at org.biojava3.alignment.SimpleSequencePair.<init>(SimpleSequencePair.java:69)
	at org.biojava3.alignment.NeedlemanWunsch.setProfile(NeedlemanWunsch.java:71)
	at org.biojava3.alignment.template.AbstractMatrixAligner.align(AbstractMatrixAligner.java:342)
	at org.biojava3.alignment.template.AbstractPairwiseSequenceAligner.getPair(AbstractPairwiseSequenceAligner.java:112)
	at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112)
	at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105)
	at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53)
	at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38)
	at java.util.concurrent.FutureTask.run(FutureTask.java:266)
	at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)
	at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
	at java.lang.Thread.run(Thread.java:745)
Caused by: java.lang.NullPointerException
	at java.util.Collections$UnmodifiableCollection.<init>(Collections.java:1026)
	at java.util.Collections$UnmodifiableList.<init>(Collections.java:1302)
	at java.util.Collections.unmodifiableList(Collections.java:1287)
	at org.biojava3.core.sequence.location.template.AbstractLocation.<init>(AbstractLocation.java:111)
	at org.biojava3.core.sequence.location.template.AbstractLocation.<init>(AbstractLocation.java:85)
	at org.biojava3.core.sequence.location.SimpleLocation.<init>(SimpleLocation.java:57)
	at org.biojava3.core.sequence.location.SimpleLocation.<init>(SimpleLocation.java:53)
	at org.biojava3.core.sequence.location.template.Location.<clinit>(Location.java:48)
	... 16 more
java.util.concurrent.ExecutionException: java.lang.NoClassDefFoundError: Could not initialize
class org.biojava3.core.sequence.location.SimpleLocation

….
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Fwd: Question about NiedlemanWunsch class

Thanks for answers!

I use 3.1. Today I checked results in SNAPSHOT version, but the problem remained.
Also I aligned sequences with themselves and recieved bad numbers  again.
As I understand it, score of alignment must be between minScore and maxScore , so similarity of sequences, which calculates according to formula

(score - minScore)/(maxScore - minScore)

must be
between 0.0 and 1.0.

Here is my code
and two sequences. Notice, that the output of "getMaxScore" method is negative.
Sorry for terrible appearance of letter, but all examples is too large.



public class NWSimilarity {

   public static void main (String[] args) {

      SubstitutionMatrix<NucleotideCompound> matrix = SubstitutionMatrixHelper.getNuc4_4();
      SimpleGapPenalty gap = new SimpleGapPenalty();

      String str1 =
      "AGATATATCTGAAGCTTAAAGGGCAGTGACAATGGCTGGCTCGGTTAACGGGAATCATAGTGCTGTAGGACCTGGTATAAATTATGAGACGGTGTCTCAAGTGGATGAGTTCTGTAAAGCACTTAGAGGGAAAAGGCCGATCCATAGTATTTTGATAGCTAACAATGGAATGGCGGCTGTGAAGTTTATACGTAGTGTCAGAACATGGGCTTATGAAACATTTGGTACGGAAAAAGCCATATTGTTGGTGGGGATGGCAACCCCTGAAGACATGCGGATCAATGCGGAGCATATCAGAATCGCTGATCAGTTTGTTGAGGTTCCCGGAGGAACCAACAATAACAATTATGCTAACGTTCAGCTGATTGTGGAGATGGCTGAAGTAACACGCGTGGATGCAGTTTGGCCTGGTTGGGGTCATGCATCTGAAAACCCCGAATTACCTGATGCCCTAGATGCAAAAGGAATCATATTTCTTGGTCCTCCAGCATCTTCAATGGCAGCACTGGGAGATAAGATTGGTTCTTCGTTGATTGCACAAGCTGCTGATGTACCCACTCTGCCATGGAGTGGTTCCCATGTTAAAATACCTCCTAATAGCAACTTGGTAACCATCCCAGAGGAGATCTACCGGCAAGCATGTGTCTACACAACTGAAGAAGCGATTGCTAGCTGTCAAGTTGTCGGTTACCCAGCAATGATCAAAGCATCGTGGGGTGGTGGTGGTAAAGGAATCAGGAAGGTTCATAATGATGATGAGGTTAGGGCTCTATTCAAGCAAGTTCAGGGTGAGGTCCCAGGCTCACCAATATTCATAATGAAGGTTGCGTCACAGAGTCGGCATCTAGAGGTCCAGCTGCTCTGTGACAAGCATGGAAATGTTTCAGCTCTGCATAGCCGTGATTGTAGCGTCCAGAGAAGACATCAAAAGATCATAGAGGAGGGTCCAATTACTGTGGCTCCGCCAGAAACTGTCAAGAAACTTGAACAAGCAGCTAGAAGGTTGGCTAAGAGTGTTAACTATGTTGGAGCTGCTACTGTTGAGTATCTCTACAGTATGGACACTGGGGAGTACTACTTCTTAGAGCTTAACCCTCGCTTACAGGTTGAGCATCCTGTCACTGAGTGGATTGCCGAGATAAATCTTCCTGCTGCCCAAGTTGCTGTGGGGATGGGAATTCCTCTCTGGCAAATCCCTGAGATAAGACGGTTCTATGGAATAGAACATGGTGGAGGTTATGATTCTTGGCGAAAAACATCTGTTGTAGCCTTCCCTTTTGATTTTGATAAAGCTCAATCTATAAGGCCAAAAGGTCATTGTGTGGCTGTACGTGTGACAAGTGAGGATCCTGATGACGGGTTCAAACCAACCAGCGGTAGAGTTCAGGAGTTGAGTTTTAAGAGCAAGCCAAATGTGTGGGCGTACTTCTCTGTCAAGTCTGGTGGAGGCATCCACGAGTTCTCGGATTCCCAGTTTGGACATGTTTTTGCATTTGGGGAATCCAGAGCCCTGGCGATAGCGAATATGGTTCTTGGGCTAAAAGAAATTCAGATCCGTGGAGAAATTAGGACTAACGTTGACTACACGATCGACCTTTTACATGCTTCTGATTACCGTGATAACAAAATTCACACTGGTTGGTTGGATAGTAGGATTGCTATGCGGGTCAGAGCTGAGAGGCCTCCATGGTATCTCTCTGTTGTCGGCGGAGCTCTCTATAAAGCATCAGCGACCAGTGCTGCTGTGGTTTCAGATTACGTTGGTTATCTGGAGAAGGGGCAAATCCCTCCAAAGCATATATCTCTTGTACATTCTCAAGTGTCTCTGAATATTGAAGGAAGTAAATATACGATTGATGTAGTCCGGGGTGGATCAGGAACCTACAGGCTAAGAATGAACAAGTCAGAAGTGGTAGCAGAAATACACACTCTACGTGATGGAGGTCTGTTGATGCAGTTGGATGGCAAAAGCCATGTGATATATGCAGAGGAAGAAGCTGCAGGAACTCGTCTTCTCATTGATGGAAGAACTTGTTTGCTACAGAATGACCACGATCCATCAAAGTTAATGGCTGAGACACCGTGCAAGTTGATGAGGTATTTGATTTCCGACAACAGCAATATTGACGCTGATACGCCTTATGCCGAAGTTGAGGTCATGAAGATGTGCATGCCACTTCTTTCACCTGCTTCAGGAGTTATCCATTTTAAAATGTCTGAAGGACAAGCCATGCAGGCTGGTGAACTTATAGCCAATCTTGATCTTGATGATCCTTCTGCTGTAAGAAAGGCCGAACCCTTCCATGGAAGTTTCCCAAGATTAGGGCTTCCAACTGCAATATCCGGTAGAGTTCATCAGAGATGTGCCGCAACATTAAATGCTGCACGCATGATTCTTGCTGGCTATGAGCATAAAGTAGATGAGGTTGTTCAAGACTTACTTAATTGCCTTGATAGCCCTGAACTCCCATTTCTTCAGTGGCAAGAGTGCTTTGCAGTTCTGGCGACACGACTACCTAAAAATCTCAGGAACATGCTAGAATCAAAGTATAGGGAATTTGAGAGTATTTCCAGAAACTCTTTGACCACCGATTTCCCTGCCAAACTTTTAAAAGGCATTCTTGAGGCACATTTATCTTCTTGTGATGAGAAAGAGAGAGGTGCCCTTGAAAGGCTCATTGAACCATTGATGAGCCTTGCAAAATCTTATGAAGGTGGTAGAGAAAGTCATGCCCGTGTTATTGTTCATTCTCTCTTTGAAGAATATCTATCAGTAGAAGAATTATTCAATGATAACATGCTGGCTGATGTTATAGAACGCATGCGTCAGCTATACAAGAAAGATCTGTTGAAAATTGTGGATATAGTGCTCTCACACCAGGGCATAAAAAACAAAAACAAACTCGTTCTCCGGCTCATGGAGCAGCTTGTTTACCCTAATCCTGCTGCTTACAGAGATAAACTTATTCGATTCTCAACACTTAACCATACTAACTACTCTGAGTTGGCGCTCAAGGCGAGTCAATTACTTGAACAGACCAAACTAAGTGAGCTTCGTTCAAACATTGCTAGAAGCCTTTCAGAGTTAGAAATGTTTACAGAGGACGGAGAAAATATGGATACTCCCAAGAGGAAAAGTGCCATTAATGAAAGAATAGAAGATCTTGTAAGCGCATCTTTAGCTGTTGAAGACGCTCTCGTGGGACTATTTGACCATAGCGATCACACACTTCAAAGACGGGTTGTTGAGACTTATATTCGCAGATTATACCAGCCCTACGTCGTTAAAGATAGCGTGAGGATGCAGTGGCACCGTTCTGGTCTTCTTGCTTCCTGGGAGTTCCTAGAGGAGCATATGGAAAGAAAAAACATTGGCTTAGACGATCCCGACACATCTGAAAAAGGATTGGTTGAGAAGCGTAGTAAGAGAAAATGGGGGGCTATGGTTATAATCAAATCTTTGCAGTTTCTTCCAAGTATAATAAGTGCAGCATTGAGAGAAACAAAGCACAACGACTATGAAACTGCCGGAGCTCCTTTATCTGGCAATATGATGCACATTGCTATTGTGGGCATCAACAACCAGATGAGTCTGCTTCAGGACAGTGGGGATGAAGACCAAGCTCAGGAAAGAGTAAACAAGTTGGCCAAAATTCTTAAAGAGGAAGAAGTGAGTTCAAGCCTCTGTTCTGCCGGTGTTGGTGTAATCAGCTGTATAATTCAGCGAGATGAAGGACGAACACCCATGAGACATTCTTTCCATTGGTCGTTGGAGAAACAGTATTATGTAGAAGAGCCGTTGCTGCGTCATCTTGAACCTCCTCTGTCCATTTACCTTGAGTTGGATAAGCTGAAAGGATACTCAAATATACAATATACGCCTTCTCGAGATCGTCAATGGCATCTGTATACTGTTACAGACAAGCCAGTGCCAATCAAGAGGATGTTCCTGAGATCTCTTGTTCGACAGGCTACAATGAACGATGGATTTATATTGCAGCAAGGGCAGGATAAGCAGCTTAGCCAAACACTGATCTCCATGGCGTTTACGTCGAAATGTGTTCTGAGGTCTTTGATGGATGCCATGGAGGAACTGGAACTGAATGCCCATAATGCTGCAATGAAACCAGATCACGCACATATGTTTCTTTGCATATTGCGTGAGCAGCAGATAGATGATCTTGTGCCTTTCCCCAGGAGAGTTGAAGTGAATGCGGAGGATGAAGAAACTACAGTTGAAATGATCTTAGAAGAAGCAGCACGAGAGATACATAGATCTGTTGGAGTGAGAATGCATAGGTTGGGCGTGTGCGAGTGGGAAGTGCGGCTGTGGTTGGTGTCCTCTGGACTGGCATGTGGTGCTTGGAGGGTTGTGGTTGCAAACGTGACAGGCCGTACATGCACTGTCCACATATACCGAGAAGTTGAAACTCCTGGAAGAAACAGTTTAATCTACCACTCAATAACCAAGAAGGGACCTTTGCATGAAACACCAATCAGTGATCAATATAAGCCCCTGGGATATCTCGACAGGCAACGTTTAGCAGCAAGGAGGAGTAACACTACTTATTGCTATGACTTCCCGTTGGCATTTGGGACAGCCTTGGAACTGTTGTGGGCATCACAACACCCAGGAGTTAAGAAACCATATAAGGATACTCTGATCAATGTTAAAGAGCTTGTATTCTCAAAACCAGAAGGTTCTTCGGGTACATCTCTAGATCTGGTTGAAAGACCACCCGGTCTCAACGACTTTGGAATGGTTGCCTGGTGCCTAGATATGTCGACCCCAGAGTTTCCTATGGGGCGGAAACTTCTCGTGATTGCGAATGATGTCACCTTCAAAGCTGGTTCTTTTGGTCCTAGAGAGGACGCGTTTTTCCTTGCTGTTACTGAACTCGCTTGTGCCAAGAAGCTTCCCTTGATTTACTTGGCAGCAAATTCTGGTGCCCGACTTGGGGTTGCTGAAGAAGTCAAAGCCTGCTTCAAAGTTGGATGGTCGGATGAAATTTCCCCTGAGAATGGTTTTCAGTATATATACCTAAGCCCTGAAGACCACGAAAGGATTGGATCATCTGTCATTGCCCATGAAGTAAAGCTCTCTAGTGGGGAAACTAGGTGGGTGATTGATACGATCGTTGGCAAAGAAGATGGTATTGGTGTAGAGAACTTAACAGGAAGTGGGGCCATAGCGGGTGCTTACTCAAAGGCATACAATGAAACTTTTACTTTAACCTTTGTTAGTGGAAGAACGGTTGGAATTGGTGCTTATCTTGCCCGCCTAGGTATGCGGTGCATACAGAGACTTGATCAGCCGATCATCTTGACTGGCTTCTCTACACTCAACAAGTTACTTGGGCGTGAGGTCTATAGCTCTCACATGCAACTGGGTGGCCCGAAAATCATGGGCACAAATGGTGTTGTTCATCTTACAGTCTCAGATGATCTTGAAGGCGTATCAGCAATTCTCAACTGGCTCAGCTACATTCCTGCTTACGTGGGTGGTCCTCTTCCTGTTCTTGCCCCTTTAGATCCACCGGAGAGAATTGTGGAGTATGTCCCAGAGAACTCTTGCGACCCACGAGCGGCTATAGCTGGGGTCAAAGACAATACCGGTAAATGGCTTGGAGGTATCTTTGATAAAAATAGTTTCATTGAGACTCTTGAAGGCTGGGCAAGGACGGTAGTGACTGGTAGAGCCAAGCTCGGGGGAATACCCGTTGGAGTTGTTGCAGTTGAGACACAGACTGTCATGCAGATCATCCCAGCCGATCCTGGACAGCTTGACTCTCATGAAAGAGTGGTTCCGCAAGCAGGGCAAGTCTGGTTTCCTGATTCAGCGGCCAAGACTGCTCAAGCGCTTATGGATTTCAACCGGGAAGAGCTTCCATTGTTTATCCTAGCGAACTGGAGAGGGTTTTCAGGTGGGCAGAGAGATCTTTTCGAAGGAATACTTCAGGCAGGTTCAACTATAGTAGAAAATCTGAGAACCTATCGTCAGCCAGTGTTTGTGTACATCCCAATGATGGGAGAGCTGCGCGGTGGAGCGTGGGTTGTTGTTGACAGCCAGATAAATTCGGATTATGTTGAAATGTATGCTGATGAAACAGCTCGTGGAAATGTGCTTGAGCCAGAAGGGACAATAGAGATAAAATTTAGAACAAAAGAGCTATTAGAGTGCATGGGAAGGTTGGACCAGAAGCTAATCAGTCTGAAAGCAAAACTGCAAGATGCCAAGCAAAGCGAGGCCTATGCAAACATCGAGCTTCTCCAGCAACAGATTAAAGCCCGAGAGAAACAGCTTTTACCAGTTTATATCCAAATCGCCACCAAATTTGCAGAACTTCATGACACTTCCATGAGAATGGCTGCAAAGGGAGTGATCAAAAGTGTTGTGGAATGGAGCGGCTCGCGGTCCTTCTTCTACAAAAAGCTCAATAGGAGAATCGCTGAGAGCTCTCTTGTGAAAAACGTAAGAGAAGCATCTGGAGACAACTTAGCATATAAATCTTCAATGCGTCTGATTCAGGATTGGTTCTGCAACTCTGATATTGCAAAGGGGAAAGAAGAAGCTTGGACAGACGACCAAGTGTTCTTTACATGGAAGGACAATGTTAGTAACTACGAGTTGAAGCTGAGCGAGTTGAGAGCGCAGAAACTACTGAACCAACTTGCAGAGATTGGGAATTCCTCAGATTTGCAAGCTCTGCCACAAGGACTTGCTAATCTTCTAAACAAGGTGGAGCCGTCGAAAAGAGAAGAGCTGGTGGCTGCTATTCGAAAGGTCTTGGGTTGACTGATATCGAAGACTTTAGCTTCTAATCCAAGAAAGATGGACATTTAAAGTTTGCTTGTGTCCGTTTGGATTGATAATTATATATTTGTTGGTCACAGTTGTAAATGTTGTTGTAGCTTTGTCATTTCCGTATAAACAAATACGCAATAATTCATTCAAC";

      String str2 =
      "TAAAGTCTTCGATATCAGTCAACCCAAGACCTTTCGAATAGCAGCCACCAGCTCTTCTCTTTTCGACGGCTCCACCTTGTTTAGAAGATTAGCAAGTCCTTGTGGCAGAGCTTGCAAATCTGAGGAATTCCCAATCTCTGCAAGTTGGTTCAGTAGTTTCTGCGCTCTCAACTCGCTCAGCTTCAACTCGTAGTTACTAACATTGTCCTTCCATGTAAAGAACACTTGGTCGTCTGTCCAAGCTTCTTCTTTCCCCTTTGCAATATCAGAGTTGCAGAACCAATCCTGAATCAGACGCATTGAAGATTTATATGCTAAGTTGTCTCCAGATGCTTCTCTTACGTTTTTTACAAGAGAGCTCTCAGCGATTCTCCTATTGAGCTTTTTGTAGAAGAAGGACCGCGAGCCGCTCCATTCCACAACACTTTTGATCACTCCCTTTGCAGCCATTCTCATGGAAGTGTCATGAAGTTCTGCAAATTTGGTGGCGATTTGGATATAAACTGGTAAAAGCTGTTTCTCTCGGGCTTTAATCTGTTGCTGGAGAAGCTCGATGTTTGCATAGGCCTCGCTTTGCTTGGCATCTTGCAGTTTTGCTTTCAGACTGATTAGCTTCTGGTCCAACCTTCCCATGCACTCTAATAGCTCTTTTGTTCTAAATTTTATCTCTATTGTCCCTTCTGGCTCGAGCACATTTCCACGAGCTGTTTCATCAGCATACATTTCAACATAATCCGAATTTATCTGGCTGTCAACAACAACCCACGCTCCACCGCGCAGCTCTCCCATCATTGGGATGTACACAAACACTGGCTGACGATAGGTTCTCAGATTTTCTACTATAGTTGAACCTGCCTGAAGTATTCCTTCGAAAAGATCTCTCTGCCCACCTGAAAACCCTCTCCAGTTCGCTAGGATAAACAATGGAAGCTCTTCCCGGTTGAAATCCATAAGTGCTTGAGCAGTCTTGGCCGCTGAATCAGGAAACCAGACTTGCCCTGCTTGCGGAACCACTCTTTCATGAGAGTCAAGCTGTCCAGGATCGGCTGGGATGATCTGCATGACAGTCTGTGTCTCAACTGCAACAACTCCAACGGGTATTCCCCCGAGCTTGGCTCTACCAGTCACTACCGTCCTTGCCCAGCCTTCAAGAGTCTCAATGAAACTATTTTTATCAAAGATACCTCCAAGCCATTTACCGGTATTGTCTTTGACCCCAGCTATAGCCGCTCGTGGGTCGCAAGAGTTCTCTGGGACATACTCCACAATTCTCTCCGGTGGATCTAAAGGGGCAAGAACAGGAAGAGGACCACCCACGTAAGCAGGAATGTAGCTGAGCCAGTTGAGAATTGCTGATACGCCTTCAAGATCATCTGAGACTGTAAGATGAACAACACCATTTGTGCCCATGATTTTCGGGCCACCCAGTTGCATGTGAGAGCTATAGACCTCACGCCCAAGTAACTTGTTGAGTGTAGAGAAGCCAGTCAAGATGATCGGCTGATCAAGTCTCTGTATGCACCGCATACCTAGGCGGGCAAGATAAGCACCAATTCCAACCGTTCTTCCACTAACAAAGGTTAAAGTAAAAGTTTCATTGTATGCCTTTGAGTAAGCACCCGCTATGGCCCCACTTCCTGTTAAGTTCTCTACACCAATACCATCTTCTTTGCCAACGATCGTATCAATCACCCACCTAGTTTCCCCACTAGGGAGCTTTACTTCATGGGCAATGACAGATGATCCAATCCTTTCGTGGTCTTCAGGGCTTAGGTATATATACTGAAAACCATTCTCAGGGGAAATTTCATCCGACCATCCAACTTTGAAGCAGGCTTTGACTTCTTCAGCAACCCCAAGTCGGGCACCAGAATTTGCTGCCAAGTAAATCAAGGGAAGCTTCTTGGCACAAGCGAGTTCAGTAACAGCAAGGAAAAACGCGTCCTCTCTAGGACCAAAAGAACCAGCTTTGAAGGTGACATCATTCGCAATCACGAGAAGTTTCCGCCCCATAGGAAACTCTGGGGTCGACATATCTAGGCACCAGGCAACCATTCCAAAGTCGTTGAGACCGGGTGGTCTTTCAACCAGATCTAGAGATGTACCCGAAGAACCTTCTGGTTTTGAGAATACAAGCTCTTTAACATTGATCAGAGTATCCTTATATGGTTTCTTAACTCCTGGGTGTTGTGATGCCCACAACAGTTCCAAGGCTGTCCCAAATGCCAACGGGAAGTCATAGCAATAAGTAGTGTTACTCCTCCTTGCTGCTAAACGTTGCCTGTCGAGATATCCCAGGGGCTTATATTGATCACTGATTGGGGTTTCATGCAAAGGTCCCTTCTTGGTTATTGAGTGGTAGATTAAACTGTTTCTTCCAGGAGTTTCAACTTCTCGGTATATGTGGACAGTGCATGTACGGCCTGTCACGTTTGCAACCACAACCCTCCAAGCACCACATGCCAGTCCAGAGGACACCAACCACAGCCGCACTTCCCACTCGCACACGCCCAACCTATGCATTCTCACTCCAACAGATCTATGTATCTCTCGTGCTGCTTCTTCTAAGATCATTTCAACTGTAGTTTCTTCATCCTCCGCATTCACTTCAACTCTCCTGGGGAAAGGCACAAGATCATCTATCTGCTGCTCACGCAATATGCAAAGAAACATATGTGCGTGATCTGGTTTCATTGCAGCATTATGGGCATTCAGTTCCAGTTCCTCCATGGCATCCATCAAAGACCTCAGAACACATTTCGACGTAAACGCCATGGAGATCAGTGTTTGGCTAAGCTGCTTATCCTGCCCTTGCTGCAATATAAATCCATCGTTCATTGTAGCCTGTCGAACAAGAGATCTCAGGAACATCCTCTTGATTGGCACTGGCTTGTCTGTAACAGTATACAGATGCCATTGACGATCTCGAGAAGGCGTATATTGTATATTTGAGTATCCTTTCAGCTTATCCAACTCAAGGTAAATGGACAGAGGAGGTTCAAGATGACGCAGCAACGGCTCTTCTACATAATACTGTTTCTCCAACGACCAATGGAAAGAATGTCTCATGGGTGTTCGTCCTTCATCTCGCTGAATTATACAGCTGATTACACCAACACCGGCAGAACAGAGGCTTGAACTCACTTCTTCCTCTTTAAGAATTTTGGCCAACTTGTTTACTCTTTCCTGAGCTTGGTCTTCATCCCCACTGTCCTGAAGCAGACTCATCTGGTTGTTGATGCCCACAATAGCAATGTGCATCATATTGCCAGATAAAGGAGCTCCGGCAGTTTCATAGTCGTTGTGCTTTGTTTCTCTCAATGCTGCACTTATTATACTTGGAAGAAACTGCAAAGATTTGATTATAACCATAGCCCCCCATTTTCTCTTACTACGCTTCTCAACCAATCCTTTTTCAGATGTGTCGTGATCGTCTAAGCCAATGTTTTTTCTTTCCATATGCTCCTCTAGGAAATCCCAGGAAGCAAGAAGACCAGAACGGTGCCACTGCATCCTCACGCTATCTTTAACGACGTAGGGCTGGTATAATCTGCGAATATAAGTCTCAACAACCCGTCTTTGAAGTGTGTGATCGCTATGGTCAAATAGTCCCACGAGAGCGTCTTCAACAGCTAAAGATGCGCTTACAAGATCTTCTATTCTTTCATTAATGGCACTTTTCCTCTTGGGAGTATCCATATTTTCTCCGTCCTCTGTAAACATTTCTAACTCTGAAAGGCTTCTAGCAATGTTTGAACGAAGCTCACTTAGTTTGGTCTGTTCAAGTAATTGACTCGCCTTGAGCGCCAACTCAGAGTAGTTAGTATGGTTAAGTGTTGAGAATCGAATAAGTTTATCTCTGTAAGCAGCAGGATTAGGGTAAACAAGCTGCTCCATGAGCCGGAGAACGAGTTTGTTTTTGTTTTTTATGCCCTGGTGTGAGAGCACTATATCCACAATTTTCAACAGATCTTTCTTGTATAGCTGACGCATGCGTTCTATAACATCAGCCAGCATGTTATCATTGAATAATTCTTCTACTGATAGATATTCTTCAAAGAGAGAATGAACAATAACACGGGCATGACTTTCTCTACCACCTTCATAAGATTTTGCAAGGCTCATCAATGGTTCAATGAGCCTTTCAAGGGCACCTCTCTCTTTCTCATCACAAGAAGATAAATGTGCCTCAAGAATGCCTTTTAAAAGTTTGGCAGGGAAATCGGTGGTCAAAGAGTTTCTGGAAATACTCTCAAATTCCCTATACTTTGATTCTAGCATGTTCCTGAGATTTTTAGGTAGTCGTGTCGCCAGAACTGCAAAGCACTCTTGCCACTGAAGAAATGGGAGTTCAGGGCTATCAAGGCAATTAAGTAAGTCTTGAACAACCTCATCTACTTTATGCTCATAGCCAGCAAGAATCATGCGTGCAGCATTTAATGTTGCGGCACATCTCTGATGAACTCTACCGGATATTGCAGTTGGAAGCCCTAATCTTGGGAAACTTCCATGGAAGGGTTCGGCCTTTCTTACAGCAGAAGGATCATCAAGATCAAGATTGGCGATAAGTTCACCAGCCTGCATGGCTTGTCCTTCAGACATTTTAAAATGGATAACTCCTGAAGCAGGTGAAAGAAGTGGCATGCACATCTTCATGACCTCAACTTCGGCATAAGGCGTATCAGCGTCAATATTGCTGTTGTCAGAAACCAAATACCTCATCAACTTGCACGGTGTCTCAGCCATTAACTTTGATGGATCATGGTCATTCTGTAGCAAACAAGTTCTTCCATCAATGAGAAGACGAGTTCCTGCAGCTTCTTCCTCTGCATATATCACATGGCTTTTGCCATCCAACTGCATCAACAGACCTCCATCACGTAGAGTGTGTATTTCTGCTACCACTTCTGACTTGTTCATTCTTAGCCTGTAGGTTCCTGATCCACCCCGGACTACATCAATCGTATATTTACTTCCTTCAATATTCAGAGACACTTGAGAATGCACAAGAGATATATGCTTTGGGGGAATTTGCCCCTTTTCTAGATAGCCAACGTAATCCGAAACTACAGCAGAACTGGTCGTAGATGCTTTATAAAGAGCCCCACCGACTACAGAGAGATACCATGGAGGTCTCTCTGCTCTGACCCGCATAGCAATCCTACTGTCCAACCAACCAGTGTGTATTTTGTTTTCCCGGTAATCAGAAGCATGTAGAAGGTCGATCGTGTAGTCAACGTTAGTCCTAATTTCTCCACGGATCTGAATTTCTTTTAGCCCAAGAACCATATTCGCTATCGCCAGGGCTCTGGATTCCCCAAATGCAAAAACATGTCCAAACTGGGAATCCGAGAACTCGTGGATGCCTCCACCAGACTTGACAGAGAAGTACGCCCACACATTTGGCTTGCTCTTAAAACTCAACTCCTGAACTCTACCGCTGGTTGGTTTGAACCCGTCATCAGGATCCTCACTTGTCACACGTACAGCCACACAATGACCTTTTGGCCTTATAGATTGAGCTTTATCAAAATCAAAAGGGAAGGCTACAACAGATGTTTTTCGCCAAGAATCATAACCTCCACCATGTTCTATTCCATAGAACCGTCTTATCTCAGGGATTTGCCAGAGAGGAATTCCCATCCCCACAGCAACTTGGGCAGCAGGAAGATTTATCTCGGCAATCCACTCAGTGACAGGATGCTCAACCTGTAAGCGAGGGTTAAGCTCTAAGAAGTAGTACTCCCCAGTGTCCATACTGTAGAGATACTCAACAGTAGCAGCTCCAACATAGTTAACACTCTTAGCCAACCTTCTAGCTGCTTGTTCAAGTTTCTTGACAGTTTCTGGCGGAGCCACAGTAATTGGACCCTCCTCTATGATCTTTTGATGTCTTCTCTGGACGCTACAATCACGGCTATGCAGAGCTGAAACATTTCCATGCTTGTCACAGAGCAGCTGGACCTCTAGATGCCGACTCTGTGACGCAACCTTCATTATGAATATTGGTGAGCCTGGGACCTCACCCTGAACTTGCTTGAATAGAGCCCTAACCTCATCATCATTATGAACCTTCCTGATTCCTTTACCACCACCACCCCACGATGCTTTGATCATTGCTGGGTAACCGACAACTTGACAGCTAGCAATCGCTTCTTCAGTTGTGTAGACACATGCTTGCCGGTAGATCTCCTCTGGGATGGTTACCAAGTTGCTATTAGGAGGTATTTTAACATGGGAACCACTCCATGGCAGAGTGGGTACATCAGCAGCTTGTGCAATCAACGAAGAACCAATCTTATCTCCCAGTGCTGCCATTGAAGATGCTGGAGGACCAAGAAATATGATTCCTTTTGCATCTAGGGCATCAGGTAATTCGGGGTTTTCAGATGCATGACCCCAACCAGGCCAAACTGCATCCACGCGTGTTACTTCAGCCATCTCCACAATCAGCTGAACGTTAGCATAATTGTTATTGTTAGTTCCTCCGGGAACCTCAACAAACTGATCAGCGATTCTGATATGCTCCGCATTGATCCGCATGTCTTCAGGGGTTGCCATCCCCACCAACAATATGGCTTTTTCCGTACCAAATGTTTCATAAGCCCATGTTCTGACACTACGTATAAACTTCACAGCCGCCATTCCATTGTTAGCTATCAAAATACTATGGATCGGCCTTTTCCCTCTAAGTGCTTTACAGAACTCATCCACTTGAGACACCGTCTCATAATTTATACCAGGTCCTACAGCACTATGATTCCCGTTAACCGAGCCAGCCATTGTCACTGCCCTTTAATCTTCAGATATATCTTGTAAGGAAGCAGA";

      DNASequence target = new DNASequence(str1,
                    AmbiguityDNACompoundSet.getDNACompoundSet());

      DNASequence query = new DNASequence(str2,
                        AmbiguityDNACompoundSet.getDNACompoundSet());

      NeedlemanWunsch aligner = new NeedlemanWunsch(query, target, gap, matrix);

      System.out.println("getScore: " + aligner.getScore());
      System.out.println("getMaxScore: " + aligner.getMaxScore());
      System.out.println("getMinScore: " + aligner.getMinScore());
      System.out.println("getSimilarity: " + aligner.getSimilarity());
   }            
}



Regards,
Alexander Beskrovnyy
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Question about NiedlemanWunsch class

Hello!
I have a problem with aligning the sequences with the help of NiedlemanWunsch class. The problem is following: I found the sequences, where method "getSimilarity" got negative numbers, but the description said: "It returns score as a similarity between 0.0 and 1.0"
I looked at the output of methods "getMaxScore", "getMinScore" and "getScore", which are involved in calculations of method "getSimilarity", and I have noticed, that "getMinScore" and "getMaxScore" got strange numbers (maxScore was less than minScore or both were negative), but output of "getScore" seemed adequate.
I used SimpleGapPenalty and SubstitutionMatrixHelper.getNuc4_4() as a parameters of constructor of NiedlemanWunsch class.
According to rules, i can’t attach file with sequences to my letter. But in case it is possible, I would kindly ask you to explain me, how to do it correctly,and then i'll send you the sequences. They are too long to be send like a text in a letter.

Thanks for your attention!

--
Regards,
Alexander Beskrovnyy
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l
Pola Kyzioł | 31 Oct 18:17 2014
Picon

Parser for MrBayes output

Hello,

my name is Pola and I'm currently a third year student in the Theoretical Computer Science
at Jagiellonian University. I have also interest in biology, especially in the field of genetics.
I've been searching a project connected with bioinformatics which I could develop
and next use to writing my bachelor's thesis. I've found BioJava and looked at its issues -
parser for MrBayes output seems for me to be interesting to code.
I would like to know some details about it: 
- what data you want extracted from MrBayes' output files;
- how the created model should look like and if appropriate modules already exist.

Thanks for your help,
Pola
_______________________________________________
Biojava-l mailing list  -  Biojava-l <at> mailman.open-bio.org
http://mailman.open-bio.org/mailman/listinfo/biojava-l

Gmane